Incidental Mutation 'R0399:Olfr215'
ID38049
Institutional Source Beutler Lab
Gene Symbol Olfr215
Ensembl Gene ENSMUSG00000050654
Gene Nameolfactory receptor 215
SynonymsMOR119-2, GA_x54KRFPKN04-58217732-58216800
MMRRC Submission 038604-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R0399 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location116580084-116584195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 116582781 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 55 (S55I)
Ref Sequence ENSEMBL: ENSMUSP00000052425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061723]
Predicted Effect probably benign
Transcript: ENSMUST00000061723
AA Change: S55I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000052425
Gene: ENSMUSG00000050654
AA Change: S55I

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 258 1.8e-5 PFAM
Pfam:7tm_1 39 288 2.9e-15 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,750,959 probably benign Het
6030452D12Rik T C 8: 106,504,542 M120T unknown Het
Actr1a A T 19: 46,385,011 probably null Het
AI314180 T C 4: 58,827,047 T1029A possibly damaging Het
Anapc5 A T 5: 122,791,753 V555D probably damaging Het
Aox1 A G 1: 58,068,849 probably null Het
Arhgap30 A G 1: 171,404,816 E343G probably damaging Het
Asap2 C T 12: 21,217,997 T291I possibly damaging Het
Atp5a1 T A 18: 77,781,836 Y439* probably null Het
Auts2 A T 5: 131,440,524 S428T probably benign Het
B3gnt7 T A 1: 86,305,711 C109* probably null Het
C4b C A 17: 34,728,869 Q1657H probably damaging Het
Cadm2 A T 16: 66,747,339 L268* probably null Het
Cep290 G A 10: 100,554,400 probably benign Het
Cep68 T G 11: 20,230,571 I687L probably benign Het
Chd6 T A 2: 161,052,688 D84V probably damaging Het
Clpx A G 9: 65,322,769 T514A probably benign Het
Cox18 A T 5: 90,215,028 C324S probably benign Het
Cryzl2 T C 1: 157,462,016 Y75H probably damaging Het
Cxcr6 C T 9: 123,810,951 A339V possibly damaging Het
Dock1 T C 7: 135,163,442 L1721P probably benign Het
Dstyk T C 1: 132,453,080 probably benign Het
Ehf A G 2: 103,266,870 Y246H probably damaging Het
Epas1 T C 17: 86,805,193 V73A probably benign Het
Filip1 A G 9: 79,818,310 I1009T possibly damaging Het
Glis3 A T 19: 28,298,768 probably benign Het
Gm17333 A T 16: 77,852,790 noncoding transcript Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Gpr155 A T 2: 73,370,002 I387N possibly damaging Het
Gria1 A G 11: 57,186,027 D83G probably damaging Het
Grid2 A G 6: 64,666,052 I933V probably benign Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Hook2 A G 8: 84,993,567 probably benign Het
Ift140 T A 17: 25,050,340 S656R possibly damaging Het
Il11ra1 A T 4: 41,766,185 T241S probably benign Het
Kank1 A G 19: 25,411,242 I760V probably benign Het
Kansl1 T C 11: 104,424,132 E360G possibly damaging Het
Klf9 A T 19: 23,142,082 S110C probably damaging Het
Klhl31 A G 9: 77,650,653 N217S probably benign Het
Lct T C 1: 128,300,525 Y1077C probably damaging Het
Lrrc49 A T 9: 60,610,246 probably benign Het
Lrrn1 T A 6: 107,569,120 H626Q probably benign Het
Mmp28 A T 11: 83,451,732 L40Q probably damaging Het
Mroh1 C T 15: 76,452,099 A1530V probably benign Het
Myo1e A G 9: 70,301,793 probably benign Het
Naa25 A T 5: 121,435,490 M761L probably benign Het
Ncln G A 10: 81,488,297 A465V probably damaging Het
Nktr A G 9: 121,731,484 N98S probably damaging Het
Olfr1012 T C 2: 85,759,904 I157M possibly damaging Het
Olfr651 T A 7: 104,553,369 V150E probably benign Het
Olfr76 G C 19: 12,120,370 A114G possibly damaging Het
Olfr878 G T 9: 37,919,553 A304S possibly damaging Het
Pacsin2 T C 15: 83,386,782 Y222C probably damaging Het
Pcdhb15 C T 18: 37,474,168 T151M possibly damaging Het
Plcz1 C A 6: 140,023,230 V161L possibly damaging Het
Ppp6c G A 2: 39,200,124 probably benign Het
Rhbdf2 T A 11: 116,603,992 Y286F probably benign Het
Rtn3 A T 19: 7,457,876 D231E probably damaging Het
Slc35c2 A C 2: 165,280,895 Y156* probably null Het
Spata46 A G 1: 170,311,537 D35G probably damaging Het
Tmed3 A G 9: 89,702,873 F110L possibly damaging Het
Tmem104 T G 11: 115,201,308 probably benign Het
Tpbg T A 9: 85,844,938 V320E possibly damaging Het
Trib2 T C 12: 15,793,663 D190G probably damaging Het
Tspan2 A G 3: 102,759,385 T26A probably damaging Het
Usp17lb A C 7: 104,841,151 Y190D possibly damaging Het
Utp18 C T 11: 93,880,147 probably benign Het
Utp20 A T 10: 88,820,979 D121E probably damaging Het
Vmn1r80 T A 7: 12,193,317 M118K possibly damaging Het
Vmn1r84 T C 7: 12,361,867 S300G probably benign Het
Other mutations in Olfr215
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01666:Olfr215 APN 6 116582335 missense possibly damaging 0.93
IGL02959:Olfr215 APN 6 116582544 missense probably damaging 1.00
IGL03053:Olfr215 APN 6 116582245 missense possibly damaging 0.50
R0078:Olfr215 UTSW 6 116582740 missense probably damaging 0.96
R0277:Olfr215 UTSW 6 116582601 missense probably damaging 0.99
R0323:Olfr215 UTSW 6 116582601 missense probably damaging 0.99
R0545:Olfr215 UTSW 6 116582656 missense probably benign 0.01
R1213:Olfr215 UTSW 6 116582866 missense probably benign 0.00
R1775:Olfr215 UTSW 6 116582964 start gained probably benign
R1789:Olfr215 UTSW 6 116582697 missense probably damaging 1.00
R4724:Olfr215 UTSW 6 116582937 missense probably damaging 1.00
R5391:Olfr215 UTSW 6 116582847 missense probably damaging 1.00
R5392:Olfr215 UTSW 6 116582418 missense probably damaging 1.00
R5686:Olfr215 UTSW 6 116582929 missense probably benign 0.00
R6124:Olfr215 UTSW 6 116582485 missense probably benign 0.05
R7080:Olfr215 UTSW 6 116582353 missense probably damaging 1.00
R7355:Olfr215 UTSW 6 116582955 start gained probably benign
Z1177:Olfr215 UTSW 6 116582553 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCAGAGGCTTGCAAATAGCTACAC -3'
(R):5'- ACCTTGAACAGGCTGCTGAATGAC -3'

Sequencing Primer
(F):5'- TGTCCACTGACATCACAGCTATG -3'
(R):5'- TGCACTGTGAGAATACCTCTG -3'
Posted On2013-05-23