Mutagenetix > Incidental Mutation

Incidental Mutation 'R4937:Rnf217'

380494

Institutional Source

Beutler Lab

Gene Symbol

Rnf217

Ensembl Gene

ENSMUSG00000063760

Gene Name

ring finger protein 217

Synonyms

Ibrdc1

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.119) question?

Stock #

R4937 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31493193-31609184 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 31517524 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 354 (I354V)

Ref Sequence

ENSEMBL: ENSMUSP00000080650 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081989]

AlphaFold

D3YYI7

Predicted Effect

probably benign
Transcript: ENSMUST00000081989
AA Change: I354V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000080650
Gene: ENSMUSG00000063760
AA Change: I354V

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
low complexity region	39	59	N/A	INTRINSIC
low complexity region	97	121	N/A	INTRINSIC
low complexity region	147	191	N/A	INTRINSIC
RING	236	280	2.01e-1	SMART
IBR	301	369	2.66e-16	SMART
IBR	376	447	3.19e-1	SMART
RING	396	425	4.87e0	SMART
transmembrane domain	479	501	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.1%
20x: 88.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene is a member of the RING1-IBR-RING24 (RBR) ubiquitin protein ligase family, and it belongs to a subfamily of these proteins that contain a transmembrane domain. This protein can interact with the HAX1 anti-apoptotic protein via its C-terminal RING finger motif, which suggests a role in apoptosis signaling. It is thought that deregulation of this gene can be a mechanism in leukemogenesis. Mutations in the region encoding the protein GXXXG motif, which appears to be necessary for protein self-association, have been found in human cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	G	5: 109,736,201	F597S	probably benign	Het
4933406M09Rik	T	A	1: 134,389,976	M162K	probably benign	Het
Aasdh	C	A	5: 76,888,654	E347*	probably null	Het
Abca16	G	T	7: 120,527,086	C1155F	probably damaging	Het
Adam26a	T	C	8: 43,568,881	D524G	probably damaging	Het
Adamts20	G	C	15: 94,379,775	H269D	probably benign	Het
Akap9	T	A	5: 4,050,145		probably null	Het
Akt3	T	C	1: 177,050,127	I358M	possibly damaging	Het
Aldh9a1	G	T	1: 167,361,807	A375S	probably damaging	Het
Alg2	A	G	4: 47,473,974	S105P	probably benign	Het
Amph	A	G	13: 19,104,345	T335A	probably damaging	Het
Ank2	C	T	3: 126,962,401	V1056M	probably damaging	Het
Apoh	A	G	11: 108,407,378	D168G	probably benign	Het
Arfgef3	C	T	10: 18,589,706	A2130T	probably damaging	Het
Arhgap30	A	G	1: 171,403,329	D218G	probably benign	Het
Ascc3	C	T	10: 50,823,798	P1906S	probably damaging	Het
Atp11b	T	G	3: 35,807,008		probably null	Het
B4galnt2	A	G	11: 95,868,429	V343A	probably damaging	Het
Barhl1	T	C	2: 28,909,773	Y280C	probably damaging	Het
Bcar1	A	T	8: 111,721,037	Y103N	probably damaging	Het
Bid	A	G	6: 120,895,746	I150T	probably benign	Het
Ccdc171	T	C	4: 83,549,639	S74P	probably damaging	Het
Ccni	A	T	5: 93,188,254		probably null	Het
Cct8l1	A	G	5: 25,516,893	E202G	probably benign	Het
Cd200r3	A	G	16: 44,954,259	K212E	probably benign	Het
Cdh19	A	G	1: 110,889,964	S683P	probably damaging	Het
Ces2b	A	T	8: 104,832,781	H93L	probably benign	Het
Clec4a1	G	A	6: 122,930,695	C114Y	probably damaging	Het
Dcc	G	T	18: 71,542,249	S636*	probably null	Het
Dcdc2c	T	C	12: 28,530,473	D187G	possibly damaging	Het
Dgkb	G	T	12: 38,114,658	E150*	probably null	Het
Dhx30	A	G	9: 110,085,961	L884P	probably damaging	Het
Dmwd	T	G	7: 19,081,303		probably null	Het
Dnah17	T	A	11: 118,042,154	N3593Y	probably damaging	Het
Dnm2	G	A	9: 21,481,337	S447N	probably benign	Het
Elk4	G	A	1: 132,017,681	G99D	probably damaging	Het
Entpd1	A	T	19: 40,739,521		probably benign	Het
Fam114a1	T	A	5: 64,979,727	D4E	probably damaging	Het
Fam160b1	T	C	19: 57,378,637	V204A	probably benign	Het
Fam166b	T	A	4: 43,427,514	Q270L	possibly damaging	Het
Fbln2	A	G	6: 91,264,699	D754G	probably damaging	Het
Foxred2	T	C	15: 77,955,835	N85S	probably damaging	Het
Fut9	A	G	4: 25,799,591		probably benign	Het
Gm13023	T	C	4: 143,793,837	V53A	possibly damaging	Het
Gm13762	T	A	2: 88,973,490	I134F	probably damaging	Het
Gm14124	C	T	2: 150,268,760	H457Y	unknown	Het
Gm1818	G	A	12: 48,559,824		noncoding transcript	Het
Gm4894	C	A	9: 49,278,700	Q92K	unknown	Het
Gpx2	T	C	12: 76,792,800	I141M	probably benign	Het
Gusb	T	C	5: 129,995,485	T476A	probably damaging	Het
Hmmr	G	A	11: 40,721,840	T180I	possibly damaging	Het
Itgbl1	T	C	14: 123,973,368	Y493H	probably benign	Het
Klhdc9	G	T	1: 171,360,383	C93*	probably null	Het
Lpar3	A	G	3: 146,284,751	K275E	probably damaging	Het
Lrp1b	A	G	2: 40,802,885		probably null	Het
Lrrc63	C	T	14: 75,084,949	G572S	probably damaging	Het
Mapk11	A	T	15: 89,146,482	D98E	probably benign	Het
Net1	G	A	13: 3,884,905	R374W	probably damaging	Het
Nlrp4g	T	A	9: 124,354,005		noncoding transcript	Het
Nrap	T	A	19: 56,347,220	Y923F	probably damaging	Het
Olfr53	T	A	7: 140,652,621	M214K	probably benign	Het
Olfr811	A	T	10: 129,802,063	V154E	probably benign	Het
Plxnc1	A	G	10: 94,841,473	V964A	probably damaging	Het
Pmfbp1	A	G	8: 109,535,866	I731V	probably benign	Het
Polq	T	A	16: 37,027,912	S294T	probably benign	Het
Pomgnt2	T	C	9: 121,982,554	D387G	probably benign	Het
Prmt2	G	A	10: 76,221,008	T227I	probably damaging	Het
Psmd1	T	A	1: 86,083,225	F341I	probably damaging	Het
Ptpn23	T	C	9: 110,392,738	M127V	probably benign	Het
Ptprc	A	G	1: 138,089,500	F483L	probably damaging	Het
Rab35	A	C	5: 115,640,088	I38L	probably damaging	Het
Rapgef6	A	G	11: 54,657,317	T486A	probably damaging	Het
Rgl3	A	T	9: 21,987,708	C68*	probably null	Het
Rilpl1	T	C	5: 124,515,531	E189G	possibly damaging	Het
Rspo3	T	C	10: 29,506,528	D50G	probably damaging	Het
Sbno1	A	G	5: 124,374,609	S1366P	possibly damaging	Het
Sema3c	A	G	5: 17,694,686	D392G	probably benign	Het
Serpinb9e	A	T	13: 33,252,952	Y85F	probably benign	Het
Shprh	C	T	10: 11,157,119	T283I	probably benign	Het
Sipa1l1	T	C	12: 82,341,329	S110P	probably benign	Het
Slc16a12	T	A	19: 34,675,243	I168F	probably damaging	Het
Slc23a3	A	G	1: 75,132,624	S221P	probably damaging	Het
Slc35b3	A	T	13: 38,932,911	I366K	possibly damaging	Het
Slc44a5	T	C	3: 154,243,615		probably null	Het
Slc5a12	A	T	2: 110,620,408	D316V	probably damaging	Het
Ssr3	A	G	3: 65,392,453	S29P	probably damaging	Het
Taf2	G	A	15: 55,027,223	Q1055*	probably null	Het
Them6	A	T	15: 74,721,518	D75V	probably damaging	Het
Tmem159	T	C	7: 120,116,312	S120P	probably damaging	Het
Tom1l2	A	G	11: 60,258,918	S239P	probably damaging	Het
Tspear	A	G	10: 77,875,043	T500A	probably damaging	Het
Tubgcp6	G	A	15: 89,101,549	A1487V	probably damaging	Het
Uba7	G	A	9: 107,978,991	V522I	possibly damaging	Het
Virma	C	A	4: 11,521,147	C901*	probably null	Het
Vmn1r172	A	T	7: 23,659,887	I66F	possibly damaging	Het
Vmn2r82	A	T	10: 79,379,176	Y331F	probably benign	Het
Wdr55	G	A	18: 36,762,398	V143I	probably benign	Het
Zbtb49	A	T	5: 38,213,963	D191E	possibly damaging	Het
Zfhx4	A	G	3: 5,242,011	H99R	probably damaging	Het
Zfp560	C	T	9: 20,347,967	C533Y	probably damaging	Het
Zfp646	C	T	7: 127,879,182	A177V	probably benign	Het
Zfp653	C	T	9: 22,055,778	E604K	probably damaging	Het

Other mutations in Rnf217

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00837:Rnf217	APN	10	31,503,774 (GRCm38)	missense	probably damaging	0.99
IGL01102:Rnf217	APN	10	31,608,503 (GRCm38)	missense	probably damaging	0.97
IGL02160:Rnf217	APN	10	31,505,771 (GRCm38)	critical splice donor site	probably null
R0582:Rnf217	UTSW	10	31,608,767 (GRCm38)	missense	possibly damaging	0.88
R0825:Rnf217	UTSW	10	31,517,457 (GRCm38)	missense	probably damaging	1.00
R1606:Rnf217	UTSW	10	31,534,811 (GRCm38)	missense	possibly damaging	0.93
R3715:Rnf217	UTSW	10	31,534,732 (GRCm38)	nonsense	probably null
R3809:Rnf217	UTSW	10	31,503,808 (GRCm38)	missense	possibly damaging	0.52
R4533:Rnf217	UTSW	10	31,608,763 (GRCm38)	missense	possibly damaging	0.73
R4606:Rnf217	UTSW	10	31,517,476 (GRCm38)	nonsense	probably null
R6683:Rnf217	UTSW	10	31,534,826 (GRCm38)	missense	possibly damaging	0.92
R6940:Rnf217	UTSW	10	31,505,977 (GRCm38)	splice site	probably null
R7751:Rnf217	UTSW	10	31,517,419 (GRCm38)	missense	probably damaging	1.00
R9668:Rnf217	UTSW	10	31,608,406 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAAATGCTGGCGTCATTCCC -3'
(R):5'- AGCAGAGTATTCCTATTTTACTGGG -3'

Sequencing Primer
(F):5'- GTCATTCCCTTCCTGCTAAGG -3'
(R):5'- AAGCAATGCTCCTCTGTGG -3'

Posted On

2016-04-15