Incidental Mutation 'R4937:Dnah17'
ID380506
Institutional Source Beutler Lab
Gene Symbol Dnah17
Ensembl Gene ENSMUSG00000033987
Gene Namedynein, axonemal, heavy chain 17
SynonymsLOC382552, Dnahcl1, 2810003K23Rik, Dnahc17
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4937 (G1)
Quality Score209
Status Not validated
Chromosome11
Chromosomal Location118021723-118130634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118042154 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 3593 (N3593Y)
Ref Sequence ENSEMBL: ENSMUSP00000081864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084803] [ENSMUST00000106308] [ENSMUST00000132685]
Predicted Effect probably damaging
Transcript: ENSMUST00000084803
AA Change: N3593Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081864
Gene: ENSMUSG00000033987
AA Change: N3593Y

DomainStartEndE-ValueType
Pfam:DHC_N1 183 766 8.5e-142 PFAM
low complexity region 1015 1028 N/A INTRINSIC
Pfam:DHC_N2 1260 1673 5.8e-135 PFAM
Pfam:AAA_6 1793 2023 6e-161 PFAM
low complexity region 2092 2104 N/A INTRINSIC
Pfam:AAA_5 2107 2243 7.8e-13 PFAM
Pfam:AAA_7 2400 2671 1.1e-171 PFAM
Pfam:AAA_8 2748 3015 4.9e-166 PFAM
Pfam:MT 3027 3370 3.4e-214 PFAM
Pfam:AAA_9 3388 3615 2.4e-144 PFAM
Pfam:Dynein_heavy 3742 4452 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106308
AA Change: N3593Y

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101915
Gene: ENSMUSG00000033987
AA Change: N3593Y

DomainStartEndE-ValueType
Pfam:DHC_N1 184 764 1.7e-152 PFAM
low complexity region 1015 1028 N/A INTRINSIC
Pfam:DHC_N2 1262 1671 4.1e-132 PFAM
Pfam:AAA_6 1793 2023 7e-149 PFAM
low complexity region 2092 2104 N/A INTRINSIC
Pfam:AAA_5 2107 2243 2.5e-11 PFAM
Pfam:AAA_7 2400 2671 4.4e-169 PFAM
Pfam:AAA_8 2748 3015 7.1e-163 PFAM
Pfam:MT 3027 3370 1.1e-210 PFAM
Pfam:AAA_9 3392 3614 1e-84 PFAM
Pfam:Dynein_heavy 3748 4479 3.5e-230 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000132685
AA Change: N3606Y
SMART Domains Protein: ENSMUSP00000120542
Gene: ENSMUSG00000033987
AA Change: N3606Y

DomainStartEndE-ValueType
Pfam:DHC_N2 279 688 3.1e-132 PFAM
Pfam:AAA_6 811 1041 5.3e-149 PFAM
low complexity region 1110 1122 N/A INTRINSIC
Blast:AAA 1123 1354 1e-104 BLAST
Pfam:AAA_7 1452 1671 8.9e-134 PFAM
Pfam:AAA_8 1763 2030 5.4e-163 PFAM
Pfam:MT 2042 2168 6.8e-52 PFAM
Pfam:MT 2163 2412 8.2e-149 PFAM
Pfam:AAA_9 2434 2656 7.9e-85 PFAM
Pfam:Dynein_heavy 2790 3457 2.6e-209 PFAM
Pfam:Dynein_heavy 3460 3569 4.6e-17 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. DNAH17 is a heavy chain associated with axonemal dynein (Milisav and Affara, 1998 [PubMed 9545504]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,736,201 F597S probably benign Het
4933406M09Rik T A 1: 134,389,976 M162K probably benign Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Abca16 G T 7: 120,527,086 C1155F probably damaging Het
Adam26a T C 8: 43,568,881 D524G probably damaging Het
Adamts20 G C 15: 94,379,775 H269D probably benign Het
Akap9 T A 5: 4,050,145 probably null Het
Akt3 T C 1: 177,050,127 I358M possibly damaging Het
Aldh9a1 G T 1: 167,361,807 A375S probably damaging Het
Alg2 A G 4: 47,473,974 S105P probably benign Het
Amph A G 13: 19,104,345 T335A probably damaging Het
Ank2 C T 3: 126,962,401 V1056M probably damaging Het
Apoh A G 11: 108,407,378 D168G probably benign Het
Arfgef3 C T 10: 18,589,706 A2130T probably damaging Het
Arhgap30 A G 1: 171,403,329 D218G probably benign Het
Ascc3 C T 10: 50,823,798 P1906S probably damaging Het
Atp11b T G 3: 35,807,008 probably null Het
B4galnt2 A G 11: 95,868,429 V343A probably damaging Het
Barhl1 T C 2: 28,909,773 Y280C probably damaging Het
Bcar1 A T 8: 111,721,037 Y103N probably damaging Het
Bid A G 6: 120,895,746 I150T probably benign Het
Ccdc171 T C 4: 83,549,639 S74P probably damaging Het
Ccni A T 5: 93,188,254 probably null Het
Cct8l1 A G 5: 25,516,893 E202G probably benign Het
Cd200r3 A G 16: 44,954,259 K212E probably benign Het
Cdh19 A G 1: 110,889,964 S683P probably damaging Het
Ces2b A T 8: 104,832,781 H93L probably benign Het
Clec4a1 G A 6: 122,930,695 C114Y probably damaging Het
Dcc G T 18: 71,542,249 S636* probably null Het
Dcdc2c T C 12: 28,530,473 D187G possibly damaging Het
Dgkb G T 12: 38,114,658 E150* probably null Het
Dhx30 A G 9: 110,085,961 L884P probably damaging Het
Dmwd T G 7: 19,081,303 probably null Het
Dnm2 G A 9: 21,481,337 S447N probably benign Het
Elk4 G A 1: 132,017,681 G99D probably damaging Het
Entpd1 A T 19: 40,739,521 probably benign Het
Fam114a1 T A 5: 64,979,727 D4E probably damaging Het
Fam160b1 T C 19: 57,378,637 V204A probably benign Het
Fam166b T A 4: 43,427,514 Q270L possibly damaging Het
Fbln2 A G 6: 91,264,699 D754G probably damaging Het
Foxred2 T C 15: 77,955,835 N85S probably damaging Het
Fut9 A G 4: 25,799,591 probably benign Het
Gm13023 T C 4: 143,793,837 V53A possibly damaging Het
Gm13762 T A 2: 88,973,490 I134F probably damaging Het
Gm14124 C T 2: 150,268,760 H457Y unknown Het
Gm1818 G A 12: 48,559,824 noncoding transcript Het
Gm4894 C A 9: 49,278,700 Q92K unknown Het
Gpx2 T C 12: 76,792,800 I141M probably benign Het
Gusb T C 5: 129,995,485 T476A probably damaging Het
Hmmr G A 11: 40,721,840 T180I possibly damaging Het
Itgbl1 T C 14: 123,973,368 Y493H probably benign Het
Klhdc9 G T 1: 171,360,383 C93* probably null Het
Lpar3 A G 3: 146,284,751 K275E probably damaging Het
Lrp1b A G 2: 40,802,885 probably null Het
Lrrc63 C T 14: 75,084,949 G572S probably damaging Het
Mapk11 A T 15: 89,146,482 D98E probably benign Het
Net1 G A 13: 3,884,905 R374W probably damaging Het
Nlrp4g T A 9: 124,354,005 noncoding transcript Het
Nrap T A 19: 56,347,220 Y923F probably damaging Het
Olfr53 T A 7: 140,652,621 M214K probably benign Het
Olfr811 A T 10: 129,802,063 V154E probably benign Het
Plxnc1 A G 10: 94,841,473 V964A probably damaging Het
Pmfbp1 A G 8: 109,535,866 I731V probably benign Het
Polq T A 16: 37,027,912 S294T probably benign Het
Pomgnt2 T C 9: 121,982,554 D387G probably benign Het
Prmt2 G A 10: 76,221,008 T227I probably damaging Het
Psmd1 T A 1: 86,083,225 F341I probably damaging Het
Ptpn23 T C 9: 110,392,738 M127V probably benign Het
Ptprc A G 1: 138,089,500 F483L probably damaging Het
Rab35 A C 5: 115,640,088 I38L probably damaging Het
Rapgef6 A G 11: 54,657,317 T486A probably damaging Het
Rgl3 A T 9: 21,987,708 C68* probably null Het
Rilpl1 T C 5: 124,515,531 E189G possibly damaging Het
Rnf217 T C 10: 31,517,524 I354V probably benign Het
Rspo3 T C 10: 29,506,528 D50G probably damaging Het
Sbno1 A G 5: 124,374,609 S1366P possibly damaging Het
Sema3c A G 5: 17,694,686 D392G probably benign Het
Serpinb9e A T 13: 33,252,952 Y85F probably benign Het
Shprh C T 10: 11,157,119 T283I probably benign Het
Sipa1l1 T C 12: 82,341,329 S110P probably benign Het
Slc16a12 T A 19: 34,675,243 I168F probably damaging Het
Slc23a3 A G 1: 75,132,624 S221P probably damaging Het
Slc35b3 A T 13: 38,932,911 I366K possibly damaging Het
Slc44a5 T C 3: 154,243,615 probably null Het
Slc5a12 A T 2: 110,620,408 D316V probably damaging Het
Ssr3 A G 3: 65,392,453 S29P probably damaging Het
Taf2 G A 15: 55,027,223 Q1055* probably null Het
Them6 A T 15: 74,721,518 D75V probably damaging Het
Tmem159 T C 7: 120,116,312 S120P probably damaging Het
Tom1l2 A G 11: 60,258,918 S239P probably damaging Het
Tspear A G 10: 77,875,043 T500A probably damaging Het
Tubgcp6 G A 15: 89,101,549 A1487V probably damaging Het
Uba7 G A 9: 107,978,991 V522I possibly damaging Het
Virma C A 4: 11,521,147 C901* probably null Het
Vmn1r172 A T 7: 23,659,887 I66F possibly damaging Het
Vmn2r82 A T 10: 79,379,176 Y331F probably benign Het
Wdr55 G A 18: 36,762,398 V143I probably benign Het
Zbtb49 A T 5: 38,213,963 D191E possibly damaging Het
Zfhx4 A G 3: 5,242,011 H99R probably damaging Het
Zfp560 C T 9: 20,347,967 C533Y probably damaging Het
Zfp646 C T 7: 127,879,182 A177V probably benign Het
Zfp653 C T 9: 22,055,778 E604K probably damaging Het
Other mutations in Dnah17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Dnah17 APN 11 118088214 missense possibly damaging 0.81
IGL00531:Dnah17 APN 11 118043173 missense probably damaging 0.97
IGL00764:Dnah17 APN 11 118096485 missense probably damaging 0.99
IGL00795:Dnah17 APN 11 118093634 missense probably benign 0.35
IGL00823:Dnah17 APN 11 118047161 missense probably benign 0.22
IGL01145:Dnah17 APN 11 118047173 missense possibly damaging 0.63
IGL01433:Dnah17 APN 11 118049934 missense probably damaging 1.00
IGL01454:Dnah17 APN 11 118058397 missense probably damaging 1.00
IGL01545:Dnah17 APN 11 118119568 missense probably damaging 1.00
IGL01548:Dnah17 APN 11 118098612 missense probably benign 0.21
IGL01557:Dnah17 APN 11 118073686 missense probably damaging 0.98
IGL01632:Dnah17 APN 11 118033881 missense probably damaging 1.00
IGL01636:Dnah17 APN 11 118041056 missense probably benign 0.03
IGL01672:Dnah17 APN 11 118042160 missense probably damaging 0.97
IGL01822:Dnah17 APN 11 118081993 missense probably damaging 1.00
IGL01869:Dnah17 APN 11 118052676 missense probably benign 0.09
IGL01916:Dnah17 APN 11 118125288 missense probably benign 0.00
IGL02131:Dnah17 APN 11 118072908 missense probably damaging 1.00
IGL02154:Dnah17 APN 11 118124261 missense probably benign 0.01
IGL02220:Dnah17 APN 11 118072967 nonsense probably null
IGL02454:Dnah17 APN 11 118080767 missense probably damaging 0.98
IGL02458:Dnah17 APN 11 118036350 missense probably damaging 1.00
IGL02588:Dnah17 APN 11 118025653 missense possibly damaging 0.95
IGL02865:Dnah17 APN 11 118073548 missense probably damaging 1.00
IGL02881:Dnah17 APN 11 118042118 missense probably damaging 1.00
IGL02952:Dnah17 APN 11 118088268 missense probably benign 0.03
IGL03382:Dnah17 APN 11 118081943 missense probably damaging 1.00
IGL03389:Dnah17 APN 11 118094979 missense probably damaging 1.00
ergos UTSW 11 118041158 splice site probably benign
watt UTSW 11 118080766 missense probably damaging 0.96
PIT4280001:Dnah17 UTSW 11 118098582 missense possibly damaging 0.85
R0004:Dnah17 UTSW 11 118060092 missense possibly damaging 0.90
R0112:Dnah17 UTSW 11 118074434 missense possibly damaging 0.82
R0116:Dnah17 UTSW 11 118058306 missense probably benign 0.01
R0157:Dnah17 UTSW 11 118127171 missense probably benign
R0320:Dnah17 UTSW 11 118052674 missense possibly damaging 0.56
R0362:Dnah17 UTSW 11 118098539 missense probably benign 0.10
R0382:Dnah17 UTSW 11 118128996 missense probably damaging 1.00
R0383:Dnah17 UTSW 11 118067547 missense probably benign
R0400:Dnah17 UTSW 11 118082078 missense probably damaging 1.00
R0420:Dnah17 UTSW 11 118039939 missense probably damaging 1.00
R0483:Dnah17 UTSW 11 118047124 missense probably benign
R0533:Dnah17 UTSW 11 118110537 missense possibly damaging 0.50
R0562:Dnah17 UTSW 11 118072900 missense probably damaging 1.00
R0564:Dnah17 UTSW 11 118082981 missense probably damaging 1.00
R0604:Dnah17 UTSW 11 118121471 missense probably benign 0.00
R0608:Dnah17 UTSW 11 118090749 nonsense probably null
R0614:Dnah17 UTSW 11 118070568 splice site probably benign
R0632:Dnah17 UTSW 11 118067682 splice site probably benign
R0831:Dnah17 UTSW 11 118060271 missense probably damaging 0.99
R0838:Dnah17 UTSW 11 118060104 missense probably damaging 1.00
R0879:Dnah17 UTSW 11 118056835 splice site probably benign
R1061:Dnah17 UTSW 11 118052688 missense possibly damaging 0.51
R1190:Dnah17 UTSW 11 118042175 missense probably damaging 1.00
R1293:Dnah17 UTSW 11 118127137 critical splice donor site probably null
R1297:Dnah17 UTSW 11 118121366 splice site probably benign
R1332:Dnah17 UTSW 11 118043215 missense possibly damaging 0.70
R1336:Dnah17 UTSW 11 118043215 missense possibly damaging 0.70
R1364:Dnah17 UTSW 11 118125606 splice site probably benign
R1418:Dnah17 UTSW 11 118074023 missense probably damaging 0.98
R1432:Dnah17 UTSW 11 118023327 missense probably damaging 1.00
R1497:Dnah17 UTSW 11 118114233 missense probably damaging 1.00
R1500:Dnah17 UTSW 11 118101053 missense probably benign
R1506:Dnah17 UTSW 11 118125387 missense possibly damaging 0.53
R1512:Dnah17 UTSW 11 118095015 missense probably benign
R1567:Dnah17 UTSW 11 118125985 missense probably damaging 1.00
R1597:Dnah17 UTSW 11 118103498 splice site probably benign
R1665:Dnah17 UTSW 11 118121495 splice site probably benign
R1703:Dnah17 UTSW 11 118026749 missense probably damaging 1.00
R1716:Dnah17 UTSW 11 118032598 missense probably benign 0.00
R1727:Dnah17 UTSW 11 118070489 missense probably damaging 0.98
R1727:Dnah17 UTSW 11 118096536 nonsense probably null
R1728:Dnah17 UTSW 11 118069519 missense possibly damaging 0.76
R1784:Dnah17 UTSW 11 118069519 missense possibly damaging 0.76
R1852:Dnah17 UTSW 11 118121916 missense probably damaging 0.97
R1869:Dnah17 UTSW 11 118047189 nonsense probably null
R1886:Dnah17 UTSW 11 118108161 missense possibly damaging 0.62
R1893:Dnah17 UTSW 11 118066968 missense probably benign 0.00
R1954:Dnah17 UTSW 11 118024731 missense probably damaging 1.00
R1969:Dnah17 UTSW 11 118104535 missense probably benign 0.00
R1971:Dnah17 UTSW 11 118104535 missense probably benign 0.00
R1975:Dnah17 UTSW 11 118096536 nonsense probably null
R1977:Dnah17 UTSW 11 118112591 missense possibly damaging 0.52
R2055:Dnah17 UTSW 11 118067531 missense probably benign 0.00
R2115:Dnah17 UTSW 11 118119802 missense probably benign 0.00
R2132:Dnah17 UTSW 11 118033747 missense probably damaging 0.98
R2200:Dnah17 UTSW 11 118102409 splice site probably benign
R2277:Dnah17 UTSW 11 118096561 missense possibly damaging 0.81
R2279:Dnah17 UTSW 11 118096561 missense possibly damaging 0.81
R2400:Dnah17 UTSW 11 118126384 critical splice acceptor site probably null
R2402:Dnah17 UTSW 11 118125974 missense probably benign 0.10
R2497:Dnah17 UTSW 11 118087024 synonymous probably null
R2923:Dnah17 UTSW 11 118093547 missense probably damaging 1.00
R3121:Dnah17 UTSW 11 118041086 missense probably damaging 1.00
R3236:Dnah17 UTSW 11 118094854 missense probably benign 0.08
R3237:Dnah17 UTSW 11 118094854 missense probably benign 0.08
R3498:Dnah17 UTSW 11 118080849 splice site probably benign
R3499:Dnah17 UTSW 11 118080849 splice site probably benign
R3746:Dnah17 UTSW 11 118082916 missense probably benign 0.00
R3749:Dnah17 UTSW 11 118082916 missense probably benign 0.00
R3762:Dnah17 UTSW 11 118104526 missense probably benign 0.00
R3826:Dnah17 UTSW 11 118041158 splice site probably benign
R3828:Dnah17 UTSW 11 118041158 splice site probably benign
R3829:Dnah17 UTSW 11 118041158 splice site probably benign
R3877:Dnah17 UTSW 11 118024707 missense probably damaging 1.00
R3899:Dnah17 UTSW 11 118094808 missense possibly damaging 0.78
R3900:Dnah17 UTSW 11 118094808 missense possibly damaging 0.78
R3911:Dnah17 UTSW 11 118080849 splice site probably benign
R3913:Dnah17 UTSW 11 118080849 splice site probably benign
R3930:Dnah17 UTSW 11 118080849 splice site probably benign
R3931:Dnah17 UTSW 11 118080849 splice site probably benign
R3969:Dnah17 UTSW 11 118041158 splice site probably benign
R3970:Dnah17 UTSW 11 118041158 splice site probably benign
R4056:Dnah17 UTSW 11 118070538 missense probably benign 0.05
R4113:Dnah17 UTSW 11 118112594 missense possibly damaging 0.50
R4295:Dnah17 UTSW 11 118118772 missense probably damaging 1.00
R4324:Dnah17 UTSW 11 118094213 missense probably benign 0.01
R4412:Dnah17 UTSW 11 118073683 missense probably damaging 1.00
R4413:Dnah17 UTSW 11 118025168 missense probably benign 0.00
R4422:Dnah17 UTSW 11 118081973 missense possibly damaging 0.91
R4552:Dnah17 UTSW 11 118052943 missense possibly damaging 0.79
R4669:Dnah17 UTSW 11 118074293 missense probably benign 0.02
R4677:Dnah17 UTSW 11 118119814 missense probably damaging 1.00
R4716:Dnah17 UTSW 11 118073648 missense probably benign 0.02
R4832:Dnah17 UTSW 11 118026780 missense probably damaging 1.00
R4868:Dnah17 UTSW 11 118108212 missense probably benign 0.03
R4897:Dnah17 UTSW 11 118078593 missense probably damaging 1.00
R4928:Dnah17 UTSW 11 118027433 missense probably damaging 1.00
R4957:Dnah17 UTSW 11 118074298 missense probably benign 0.44
R5008:Dnah17 UTSW 11 118110577 missense probably benign 0.01
R5016:Dnah17 UTSW 11 118080766 missense probably damaging 0.96
R5027:Dnah17 UTSW 11 118102539 missense probably benign 0.01
R5133:Dnah17 UTSW 11 118117113 missense probably benign 0.00
R5140:Dnah17 UTSW 11 118086945 missense probably damaging 1.00
R5146:Dnah17 UTSW 11 118114179 missense probably damaging 0.99
R5151:Dnah17 UTSW 11 118027467 missense probably damaging 1.00
R5153:Dnah17 UTSW 11 118082974 nonsense probably null
R5192:Dnah17 UTSW 11 118034359 missense possibly damaging 0.96
R5315:Dnah17 UTSW 11 118127283 missense possibly damaging 0.79
R5317:Dnah17 UTSW 11 118127283 missense possibly damaging 0.79
R5335:Dnah17 UTSW 11 118112514 missense probably damaging 1.00
R5379:Dnah17 UTSW 11 118117203 intron probably benign
R5396:Dnah17 UTSW 11 118127282 missense probably benign
R5418:Dnah17 UTSW 11 118094984 missense probably benign 0.04
R5534:Dnah17 UTSW 11 118052770 missense possibly damaging 0.83
R5539:Dnah17 UTSW 11 118073660 missense probably benign 0.03
R5594:Dnah17 UTSW 11 118043229 splice site probably null
R5634:Dnah17 UTSW 11 118052926 splice site probably null
R5696:Dnah17 UTSW 11 118101056 missense probably benign 0.44
R5802:Dnah17 UTSW 11 118036446 missense possibly damaging 0.79
R5826:Dnah17 UTSW 11 118034367 missense probably damaging 1.00
R5873:Dnah17 UTSW 11 118056897 missense probably benign 0.01
R5898:Dnah17 UTSW 11 118114213 missense probably benign 0.00
R5934:Dnah17 UTSW 11 118041102 missense probably benign
R6030:Dnah17 UTSW 11 118025549 missense probably benign 0.32
R6030:Dnah17 UTSW 11 118025549 missense probably benign 0.32
R6038:Dnah17 UTSW 11 118055889 missense probably benign 0.00
R6038:Dnah17 UTSW 11 118055889 missense probably benign 0.00
R6113:Dnah17 UTSW 11 118126275 missense probably damaging 1.00
R6117:Dnah17 UTSW 11 118119571 missense probably benign 0.00
R6137:Dnah17 UTSW 11 118025654 missense probably damaging 1.00
R6173:Dnah17 UTSW 11 118039946 missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118126322 missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118126323 nonsense probably null
R6258:Dnah17 UTSW 11 118126324 missense probably damaging 1.00
R6260:Dnah17 UTSW 11 118126322 missense probably damaging 1.00
R6260:Dnah17 UTSW 11 118126323 nonsense probably null
R6260:Dnah17 UTSW 11 118126324 missense probably damaging 1.00
R6278:Dnah17 UTSW 11 118126290 missense probably damaging 0.99
R6298:Dnah17 UTSW 11 118108161 missense probably benign 0.00
R6300:Dnah17 UTSW 11 118034310 missense probably damaging 1.00
R6302:Dnah17 UTSW 11 118129155 missense probably benign 0.09
R6363:Dnah17 UTSW 11 118110505 missense probably benign
R6381:Dnah17 UTSW 11 118129185 missense probably benign 0.08
R6418:Dnah17 UTSW 11 118129197 missense probably damaging 0.99
R6660:Dnah17 UTSW 11 118100188 missense probably benign
R6803:Dnah17 UTSW 11 118125372 missense probably benign 0.00
R6820:Dnah17 UTSW 11 118069000 missense probably damaging 0.99
R6885:Dnah17 UTSW 11 118090772 missense possibly damaging 0.47
R6921:Dnah17 UTSW 11 118041484 missense probably damaging 0.98
R6932:Dnah17 UTSW 11 118060079 missense possibly damaging 0.95
R6954:Dnah17 UTSW 11 118066432 missense probably damaging 1.00
R7000:Dnah17 UTSW 11 118025702 critical splice acceptor site probably null
R7007:Dnah17 UTSW 11 118118871 missense possibly damaging 0.92
R7048:Dnah17 UTSW 11 118046118 missense possibly damaging 0.80
R7056:Dnah17 UTSW 11 118125386 missense probably benign
R7131:Dnah17 UTSW 11 118079658 missense probably benign 0.14
R7143:Dnah17 UTSW 11 118086130 missense probably damaging 1.00
R7146:Dnah17 UTSW 11 118082110 missense probably damaging 0.98
R7147:Dnah17 UTSW 11 118094929 missense probably benign 0.31
R7172:Dnah17 UTSW 11 118041131 nonsense probably null
R7183:Dnah17 UTSW 11 118129188 missense probably benign
R7297:Dnah17 UTSW 11 118055730 critical splice donor site probably null
R7297:Dnah17 UTSW 11 118103356 missense probably damaging 0.98
R7367:Dnah17 UTSW 11 118115196 missense probably benign
R7398:Dnah17 UTSW 11 118080724 missense probably damaging 0.96
R7426:Dnah17 UTSW 11 118090717 missense probably null 0.79
R7524:Dnah17 UTSW 11 118121481 missense probably benign 0.03
R7529:Dnah17 UTSW 11 118049866 critical splice donor site probably null
R7615:Dnah17 UTSW 11 118110547 nonsense probably null
R7681:Dnah17 UTSW 11 118025186 missense probably damaging 1.00
R7702:Dnah17 UTSW 11 118025640 missense probably benign 0.00
R7702:Dnah17 UTSW 11 118121478 missense possibly damaging 0.64
R7713:Dnah17 UTSW 11 118025171 missense probably benign 0.02
X0058:Dnah17 UTSW 11 118082925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTTCAGGTAGCAGGATGC -3'
(R):5'- GGTGTCATTTCTCCTGCTGCAG -3'

Sequencing Primer
(F):5'- ACAGTTCCAGGTGACAGCCTATTG -3'
(R):5'- CTGCTGCAGGGCTGACC -3'
Posted On2016-04-15