Incidental Mutation 'R4937:Amph'
ID 380515
Institutional Source Beutler Lab
Gene Symbol Amph
Ensembl Gene ENSMUSG00000021314
Gene Name amphiphysin
Synonyms
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.301) question?
Stock # R4937 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 18948205-19150921 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19104345 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 335 (T335A)
Ref Sequence ENSEMBL: ENSMUSP00000003345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003345] [ENSMUST00000200466]
AlphaFold Q7TQF7
Predicted Effect probably damaging
Transcript: ENSMUST00000003345
AA Change: T335A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003345
Gene: ENSMUSG00000021314
AA Change: T335A

DomainStartEndE-ValueType
BAR 12 233 8.47e-80 SMART
low complexity region 260 277 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
low complexity region 301 315 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 424 445 N/A INTRINSIC
low complexity region 479 499 N/A INTRINSIC
SH3 616 686 7.82e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200273
Predicted Effect probably damaging
Transcript: ENSMUST00000200466
AA Change: T335A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142766
Gene: ENSMUSG00000021314
AA Change: T335A

DomainStartEndE-ValueType
BAR 12 233 2.3e-82 SMART
low complexity region 260 277 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
low complexity region 301 315 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 428 449 N/A INTRINSIC
low complexity region 483 503 N/A INTRINSIC
SH3 620 690 4.9e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222698
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the cytoplasmic surface of synaptic vesicles. A subset of patients with stiff-man syndrome who were also affected by breast cancer are positive for autoantibodies against this protein. Alternate splicing of this gene results in two transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences have not been determined. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene exhibit learning deficits and synaptic vesicle recycling defects, and die between 2 to 5 months of age from rare irreversible seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,736,201 F597S probably benign Het
4933406M09Rik T A 1: 134,389,976 M162K probably benign Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Abca16 G T 7: 120,527,086 C1155F probably damaging Het
Adam26a T C 8: 43,568,881 D524G probably damaging Het
Adamts20 G C 15: 94,379,775 H269D probably benign Het
Akap9 T A 5: 4,050,145 probably null Het
Akt3 T C 1: 177,050,127 I358M possibly damaging Het
Aldh9a1 G T 1: 167,361,807 A375S probably damaging Het
Alg2 A G 4: 47,473,974 S105P probably benign Het
Ank2 C T 3: 126,962,401 V1056M probably damaging Het
Apoh A G 11: 108,407,378 D168G probably benign Het
Arfgef3 C T 10: 18,589,706 A2130T probably damaging Het
Arhgap30 A G 1: 171,403,329 D218G probably benign Het
Ascc3 C T 10: 50,823,798 P1906S probably damaging Het
Atp11b T G 3: 35,807,008 probably null Het
B4galnt2 A G 11: 95,868,429 V343A probably damaging Het
Barhl1 T C 2: 28,909,773 Y280C probably damaging Het
Bcar1 A T 8: 111,721,037 Y103N probably damaging Het
Bid A G 6: 120,895,746 I150T probably benign Het
Ccdc171 T C 4: 83,549,639 S74P probably damaging Het
Ccni A T 5: 93,188,254 probably null Het
Cct8l1 A G 5: 25,516,893 E202G probably benign Het
Cd200r3 A G 16: 44,954,259 K212E probably benign Het
Cdh19 A G 1: 110,889,964 S683P probably damaging Het
Ces2b A T 8: 104,832,781 H93L probably benign Het
Clec4a1 G A 6: 122,930,695 C114Y probably damaging Het
Dcc G T 18: 71,542,249 S636* probably null Het
Dcdc2c T C 12: 28,530,473 D187G possibly damaging Het
Dgkb G T 12: 38,114,658 E150* probably null Het
Dhx30 A G 9: 110,085,961 L884P probably damaging Het
Dmwd T G 7: 19,081,303 probably null Het
Dnah17 T A 11: 118,042,154 N3593Y probably damaging Het
Dnm2 G A 9: 21,481,337 S447N probably benign Het
Elk4 G A 1: 132,017,681 G99D probably damaging Het
Entpd1 A T 19: 40,739,521 probably benign Het
Fam114a1 T A 5: 64,979,727 D4E probably damaging Het
Fam160b1 T C 19: 57,378,637 V204A probably benign Het
Fam166b T A 4: 43,427,514 Q270L possibly damaging Het
Fbln2 A G 6: 91,264,699 D754G probably damaging Het
Foxred2 T C 15: 77,955,835 N85S probably damaging Het
Fut9 A G 4: 25,799,591 probably benign Het
Gm13023 T C 4: 143,793,837 V53A possibly damaging Het
Gm13762 T A 2: 88,973,490 I134F probably damaging Het
Gm14124 C T 2: 150,268,760 H457Y unknown Het
Gm1818 G A 12: 48,559,824 noncoding transcript Het
Gm4894 C A 9: 49,278,700 Q92K unknown Het
Gpx2 T C 12: 76,792,800 I141M probably benign Het
Gusb T C 5: 129,995,485 T476A probably damaging Het
Hmmr G A 11: 40,721,840 T180I possibly damaging Het
Itgbl1 T C 14: 123,973,368 Y493H probably benign Het
Klhdc9 G T 1: 171,360,383 C93* probably null Het
Lpar3 A G 3: 146,284,751 K275E probably damaging Het
Lrp1b A G 2: 40,802,885 probably null Het
Lrrc63 C T 14: 75,084,949 G572S probably damaging Het
Mapk11 A T 15: 89,146,482 D98E probably benign Het
Net1 G A 13: 3,884,905 R374W probably damaging Het
Nlrp4g T A 9: 124,354,005 noncoding transcript Het
Nrap T A 19: 56,347,220 Y923F probably damaging Het
Olfr53 T A 7: 140,652,621 M214K probably benign Het
Olfr811 A T 10: 129,802,063 V154E probably benign Het
Plxnc1 A G 10: 94,841,473 V964A probably damaging Het
Pmfbp1 A G 8: 109,535,866 I731V probably benign Het
Polq T A 16: 37,027,912 S294T probably benign Het
Pomgnt2 T C 9: 121,982,554 D387G probably benign Het
Prmt2 G A 10: 76,221,008 T227I probably damaging Het
Psmd1 T A 1: 86,083,225 F341I probably damaging Het
Ptpn23 T C 9: 110,392,738 M127V probably benign Het
Ptprc A G 1: 138,089,500 F483L probably damaging Het
Rab35 A C 5: 115,640,088 I38L probably damaging Het
Rapgef6 A G 11: 54,657,317 T486A probably damaging Het
Rgl3 A T 9: 21,987,708 C68* probably null Het
Rilpl1 T C 5: 124,515,531 E189G possibly damaging Het
Rnf217 T C 10: 31,517,524 I354V probably benign Het
Rspo3 T C 10: 29,506,528 D50G probably damaging Het
Sbno1 A G 5: 124,374,609 S1366P possibly damaging Het
Sema3c A G 5: 17,694,686 D392G probably benign Het
Serpinb9e A T 13: 33,252,952 Y85F probably benign Het
Shprh C T 10: 11,157,119 T283I probably benign Het
Sipa1l1 T C 12: 82,341,329 S110P probably benign Het
Slc16a12 T A 19: 34,675,243 I168F probably damaging Het
Slc23a3 A G 1: 75,132,624 S221P probably damaging Het
Slc35b3 A T 13: 38,932,911 I366K possibly damaging Het
Slc44a5 T C 3: 154,243,615 probably null Het
Slc5a12 A T 2: 110,620,408 D316V probably damaging Het
Ssr3 A G 3: 65,392,453 S29P probably damaging Het
Taf2 G A 15: 55,027,223 Q1055* probably null Het
Them6 A T 15: 74,721,518 D75V probably damaging Het
Tmem159 T C 7: 120,116,312 S120P probably damaging Het
Tom1l2 A G 11: 60,258,918 S239P probably damaging Het
Tspear A G 10: 77,875,043 T500A probably damaging Het
Tubgcp6 G A 15: 89,101,549 A1487V probably damaging Het
Uba7 G A 9: 107,978,991 V522I possibly damaging Het
Virma C A 4: 11,521,147 C901* probably null Het
Vmn1r172 A T 7: 23,659,887 I66F possibly damaging Het
Vmn2r82 A T 10: 79,379,176 Y331F probably benign Het
Wdr55 G A 18: 36,762,398 V143I probably benign Het
Zbtb49 A T 5: 38,213,963 D191E possibly damaging Het
Zfhx4 A G 3: 5,242,011 H99R probably damaging Het
Zfp560 C T 9: 20,347,967 C533Y probably damaging Het
Zfp646 C T 7: 127,879,182 A177V probably benign Het
Zfp653 C T 9: 22,055,778 E604K probably damaging Het
Other mutations in Amph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Amph APN 13 19120606 missense probably damaging 1.00
IGL01866:Amph APN 13 19142002 missense probably damaging 1.00
IGL02157:Amph APN 13 19104231 missense possibly damaging 0.60
IGL02300:Amph APN 13 19086604 missense probably damaging 1.00
IGL02435:Amph APN 13 19139163 splice site probably benign
IGL03060:Amph APN 13 19094814 missense probably damaging 0.99
IGL03122:Amph APN 13 19102943 missense probably damaging 0.98
R0037:Amph UTSW 13 19100653 missense possibly damaging 0.90
R0646:Amph UTSW 13 19113116 missense possibly damaging 0.95
R0652:Amph UTSW 13 19086621 splice site probably null
R1005:Amph UTSW 13 19142028 missense probably damaging 0.97
R1006:Amph UTSW 13 19142028 missense probably damaging 0.97
R1199:Amph UTSW 13 19142028 missense probably damaging 0.97
R1200:Amph UTSW 13 19142028 missense probably damaging 0.97
R1201:Amph UTSW 13 19142028 missense probably damaging 0.97
R1333:Amph UTSW 13 19142028 missense probably damaging 0.97
R1334:Amph UTSW 13 19142028 missense probably damaging 0.97
R1335:Amph UTSW 13 19142028 missense probably damaging 0.97
R1337:Amph UTSW 13 19142028 missense probably damaging 0.97
R1338:Amph UTSW 13 19142028 missense probably damaging 0.97
R1384:Amph UTSW 13 19142028 missense probably damaging 0.97
R1397:Amph UTSW 13 19142028 missense probably damaging 0.97
R1501:Amph UTSW 13 19104291 nonsense probably null
R1528:Amph UTSW 13 19142028 missense probably damaging 0.97
R1822:Amph UTSW 13 18948455 missense probably damaging 0.98
R2004:Amph UTSW 13 19142028 missense probably damaging 0.97
R2006:Amph UTSW 13 19142028 missense probably damaging 0.97
R2061:Amph UTSW 13 19125035 nonsense probably null
R2111:Amph UTSW 13 19116266 splice site probably benign
R2329:Amph UTSW 13 19139350 missense probably benign
R2878:Amph UTSW 13 19104267 missense possibly damaging 0.95
R3121:Amph UTSW 13 19113146 nonsense probably null
R3548:Amph UTSW 13 19102959 missense probably damaging 1.00
R4059:Amph UTSW 13 19141998 missense probably damaging 1.00
R4369:Amph UTSW 13 19137700 missense probably benign 0.20
R4492:Amph UTSW 13 19149758 missense possibly damaging 0.76
R4855:Amph UTSW 13 19084208 missense probably damaging 1.00
R4965:Amph UTSW 13 19137699 missense probably benign 0.12
R5777:Amph UTSW 13 19046016 missense probably damaging 1.00
R5787:Amph UTSW 13 18948454 missense possibly damaging 0.75
R6091:Amph UTSW 13 19125123 missense probably benign 0.01
R7100:Amph UTSW 13 19149841 makesense probably null
R7103:Amph UTSW 13 19149738 missense probably benign 0.00
R7451:Amph UTSW 13 19077368 missense probably damaging 1.00
R7522:Amph UTSW 13 19086545 missense probably damaging 0.96
R8165:Amph UTSW 13 19094837 missense probably benign 0.05
R8166:Amph UTSW 13 18948490 missense possibly damaging 0.91
R8214:Amph UTSW 13 19104298 missense possibly damaging 0.81
R9021:Amph UTSW 13 19099901 missense probably benign 0.35
R9241:Amph UTSW 13 19094802 missense probably damaging 1.00
R9469:Amph UTSW 13 19086599 missense probably damaging 1.00
R9717:Amph UTSW 13 19125083 missense probably benign 0.07
R9755:Amph UTSW 13 19113155 missense probably damaging 1.00
V1662:Amph UTSW 13 19139370 missense probably benign 0.36
Z1177:Amph UTSW 13 19139334 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- CCATAGCTGGGCTTATCTGACAC -3'
(R):5'- AGGATGACAGCGACTCCTATTC -3'

Sequencing Primer
(F):5'- GGCTTATCTGACACTTCCTCAAAGG -3'
(R):5'- GTACTTTCTCTACAGCTGACC -3'
Posted On 2016-04-15