Incidental Mutation 'R4937:Serpinb9e'
ID380516
Institutional Source Beutler Lab
Gene Symbol Serpinb9e
Ensembl Gene ENSMUSG00000062342
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9e
SynonymsSpi14, ovalbumin, NK26
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R4937 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location33249612-33260850 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33252952 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 85 (Y85F)
Ref Sequence ENSEMBL: ENSMUSP00000071769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071873]
Predicted Effect probably benign
Transcript: ENSMUST00000071873
AA Change: Y85F

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000071769
Gene: ENSMUSG00000062342
AA Change: Y85F

DomainStartEndE-ValueType
SERPIN 13 377 1.82e-168 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,736,201 F597S probably benign Het
4933406M09Rik T A 1: 134,389,976 M162K probably benign Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Abca16 G T 7: 120,527,086 C1155F probably damaging Het
Adam26a T C 8: 43,568,881 D524G probably damaging Het
Adamts20 G C 15: 94,379,775 H269D probably benign Het
Akap9 T A 5: 4,050,145 probably null Het
Akt3 T C 1: 177,050,127 I358M possibly damaging Het
Aldh9a1 G T 1: 167,361,807 A375S probably damaging Het
Alg2 A G 4: 47,473,974 S105P probably benign Het
Amph A G 13: 19,104,345 T335A probably damaging Het
Ank2 C T 3: 126,962,401 V1056M probably damaging Het
Apoh A G 11: 108,407,378 D168G probably benign Het
Arfgef3 C T 10: 18,589,706 A2130T probably damaging Het
Arhgap30 A G 1: 171,403,329 D218G probably benign Het
Ascc3 C T 10: 50,823,798 P1906S probably damaging Het
Atp11b T G 3: 35,807,008 probably null Het
B4galnt2 A G 11: 95,868,429 V343A probably damaging Het
Barhl1 T C 2: 28,909,773 Y280C probably damaging Het
Bcar1 A T 8: 111,721,037 Y103N probably damaging Het
Bid A G 6: 120,895,746 I150T probably benign Het
Ccdc171 T C 4: 83,549,639 S74P probably damaging Het
Ccni A T 5: 93,188,254 probably null Het
Cct8l1 A G 5: 25,516,893 E202G probably benign Het
Cd200r3 A G 16: 44,954,259 K212E probably benign Het
Cdh19 A G 1: 110,889,964 S683P probably damaging Het
Ces2b A T 8: 104,832,781 H93L probably benign Het
Clec4a1 G A 6: 122,930,695 C114Y probably damaging Het
Dcc G T 18: 71,542,249 S636* probably null Het
Dcdc2c T C 12: 28,530,473 D187G possibly damaging Het
Dgkb G T 12: 38,114,658 E150* probably null Het
Dhx30 A G 9: 110,085,961 L884P probably damaging Het
Dmwd T G 7: 19,081,303 probably null Het
Dnah17 T A 11: 118,042,154 N3593Y probably damaging Het
Dnm2 G A 9: 21,481,337 S447N probably benign Het
Elk4 G A 1: 132,017,681 G99D probably damaging Het
Entpd1 A T 19: 40,739,521 probably benign Het
Fam114a1 T A 5: 64,979,727 D4E probably damaging Het
Fam160b1 T C 19: 57,378,637 V204A probably benign Het
Fam166b T A 4: 43,427,514 Q270L possibly damaging Het
Fbln2 A G 6: 91,264,699 D754G probably damaging Het
Foxred2 T C 15: 77,955,835 N85S probably damaging Het
Fut9 A G 4: 25,799,591 probably benign Het
Gm13023 T C 4: 143,793,837 V53A possibly damaging Het
Gm13762 T A 2: 88,973,490 I134F probably damaging Het
Gm14124 C T 2: 150,268,760 H457Y unknown Het
Gm1818 G A 12: 48,559,824 noncoding transcript Het
Gm4894 C A 9: 49,278,700 Q92K unknown Het
Gpx2 T C 12: 76,792,800 I141M probably benign Het
Gusb T C 5: 129,995,485 T476A probably damaging Het
Hmmr G A 11: 40,721,840 T180I possibly damaging Het
Itgbl1 T C 14: 123,973,368 Y493H probably benign Het
Klhdc9 G T 1: 171,360,383 C93* probably null Het
Lpar3 A G 3: 146,284,751 K275E probably damaging Het
Lrp1b A G 2: 40,802,885 probably null Het
Lrrc63 C T 14: 75,084,949 G572S probably damaging Het
Mapk11 A T 15: 89,146,482 D98E probably benign Het
Net1 G A 13: 3,884,905 R374W probably damaging Het
Nlrp4g T A 9: 124,354,005 noncoding transcript Het
Nrap T A 19: 56,347,220 Y923F probably damaging Het
Olfr53 T A 7: 140,652,621 M214K probably benign Het
Olfr811 A T 10: 129,802,063 V154E probably benign Het
Plxnc1 A G 10: 94,841,473 V964A probably damaging Het
Pmfbp1 A G 8: 109,535,866 I731V probably benign Het
Polq T A 16: 37,027,912 S294T probably benign Het
Pomgnt2 T C 9: 121,982,554 D387G probably benign Het
Prmt2 G A 10: 76,221,008 T227I probably damaging Het
Psmd1 T A 1: 86,083,225 F341I probably damaging Het
Ptpn23 T C 9: 110,392,738 M127V probably benign Het
Ptprc A G 1: 138,089,500 F483L probably damaging Het
Rab35 A C 5: 115,640,088 I38L probably damaging Het
Rapgef6 A G 11: 54,657,317 T486A probably damaging Het
Rgl3 A T 9: 21,987,708 C68* probably null Het
Rilpl1 T C 5: 124,515,531 E189G possibly damaging Het
Rnf217 T C 10: 31,517,524 I354V probably benign Het
Rspo3 T C 10: 29,506,528 D50G probably damaging Het
Sbno1 A G 5: 124,374,609 S1366P possibly damaging Het
Sema3c A G 5: 17,694,686 D392G probably benign Het
Shprh C T 10: 11,157,119 T283I probably benign Het
Sipa1l1 T C 12: 82,341,329 S110P probably benign Het
Slc16a12 T A 19: 34,675,243 I168F probably damaging Het
Slc23a3 A G 1: 75,132,624 S221P probably damaging Het
Slc35b3 A T 13: 38,932,911 I366K possibly damaging Het
Slc44a5 T C 3: 154,243,615 probably null Het
Slc5a12 A T 2: 110,620,408 D316V probably damaging Het
Ssr3 A G 3: 65,392,453 S29P probably damaging Het
Taf2 G A 15: 55,027,223 Q1055* probably null Het
Them6 A T 15: 74,721,518 D75V probably damaging Het
Tmem159 T C 7: 120,116,312 S120P probably damaging Het
Tom1l2 A G 11: 60,258,918 S239P probably damaging Het
Tspear A G 10: 77,875,043 T500A probably damaging Het
Tubgcp6 G A 15: 89,101,549 A1487V probably damaging Het
Uba7 G A 9: 107,978,991 V522I possibly damaging Het
Virma C A 4: 11,521,147 C901* probably null Het
Vmn1r172 A T 7: 23,659,887 I66F possibly damaging Het
Vmn2r82 A T 10: 79,379,176 Y331F probably benign Het
Wdr55 G A 18: 36,762,398 V143I probably benign Het
Zbtb49 A T 5: 38,213,963 D191E possibly damaging Het
Zfhx4 A G 3: 5,242,011 H99R probably damaging Het
Zfp560 C T 9: 20,347,967 C533Y probably damaging Het
Zfp646 C T 7: 127,879,182 A177V probably benign Het
Zfp653 C T 9: 22,055,778 E604K probably damaging Het
Other mutations in Serpinb9e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01619:Serpinb9e APN 13 33255125 missense probably damaging 0.97
IGL02352:Serpinb9e APN 13 33257820 splice site probably benign
IGL02359:Serpinb9e APN 13 33257820 splice site probably benign
IGL02604:Serpinb9e APN 13 33257759 missense probably benign 0.00
IGL02859:Serpinb9e APN 13 33251650 missense possibly damaging 0.83
R0257:Serpinb9e UTSW 13 33257681 missense probably benign 0.24
R0751:Serpinb9e UTSW 13 33259774 missense probably benign 0.00
R1101:Serpinb9e UTSW 13 33260088 missense probably benign 0.10
R1170:Serpinb9e UTSW 13 33257752 nonsense probably null
R1184:Serpinb9e UTSW 13 33259774 missense probably benign 0.00
R1253:Serpinb9e UTSW 13 33255119 missense possibly damaging 0.77
R1405:Serpinb9e UTSW 13 33260026 missense probably benign
R1405:Serpinb9e UTSW 13 33260026 missense probably benign
R1463:Serpinb9e UTSW 13 33255116 missense probably benign
R1566:Serpinb9e UTSW 13 33253494 missense probably damaging 1.00
R1924:Serpinb9e UTSW 13 33253445 missense probably benign 0.07
R1964:Serpinb9e UTSW 13 33253491 missense probably benign 0.04
R2153:Serpinb9e UTSW 13 33252978 missense probably damaging 1.00
R2405:Serpinb9e UTSW 13 33260080 missense probably benign
R2972:Serpinb9e UTSW 13 33255143 missense probably benign
R2973:Serpinb9e UTSW 13 33255143 missense probably benign
R2974:Serpinb9e UTSW 13 33255143 missense probably benign
R3854:Serpinb9e UTSW 13 33255154 missense probably benign 0.40
R4173:Serpinb9e UTSW 13 33255158 missense probably damaging 0.97
R4949:Serpinb9e UTSW 13 33251608 missense possibly damaging 0.81
R5347:Serpinb9e UTSW 13 33257784 missense probably damaging 1.00
R5976:Serpinb9e UTSW 13 33255129 missense probably benign
R5979:Serpinb9e UTSW 13 33255053 missense probably benign 0.18
R5991:Serpinb9e UTSW 13 33259807 missense probably damaging 1.00
R6059:Serpinb9e UTSW 13 33257774 missense probably benign 0.29
R6884:Serpinb9e UTSW 13 33251626 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ACTGGGAATGAAGGTCAATTCCTAC -3'
(R):5'- AGTGGCTGGCACTTAATCC -3'

Sequencing Primer
(F):5'- CCCAGTTACATGGCAGTCTGTG -3'
(R):5'- GTGGCTGGCACTTAATCCTACTTTTC -3'
Posted On2016-04-15