Mutagenetix > Incidental Mutation

Incidental Mutation 'R4937:Taf2'

380521

Institutional Source

Beutler Lab

Gene Symbol

Taf2

Ensembl Gene

ENSMUSG00000037343

Gene Name

TATA-box binding protein associated factor 2

Synonyms

CIF150, 150kDa, TAF2B, 4732460C16Rik, TAFII150

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4937 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55015131-55072152 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 55027223 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 1055 (Q1055*)

Ref Sequence

ENSEMBL: ENSMUSP00000043733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041733]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000041733
AA Change: Q1055*

SMART Domains

Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343
AA Change: Q1055*

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M1	21	406	5.6e-17	PFAM
SCOP:d1gw5a_	606	973	6e-7	SMART
low complexity region	987	998	N/A	INTRINSIC
low complexity region	1142	1175	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228345

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228896

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.1%
20x: 88.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	G	5: 109,736,201	F597S	probably benign	Het
4933406M09Rik	T	A	1: 134,389,976	M162K	probably benign	Het
Aasdh	C	A	5: 76,888,654	E347*	probably null	Het
Abca16	G	T	7: 120,527,086	C1155F	probably damaging	Het
Adam26a	T	C	8: 43,568,881	D524G	probably damaging	Het
Adamts20	G	C	15: 94,379,775	H269D	probably benign	Het
Akap9	T	A	5: 4,050,145		probably null	Het
Akt3	T	C	1: 177,050,127	I358M	possibly damaging	Het
Aldh9a1	G	T	1: 167,361,807	A375S	probably damaging	Het
Alg2	A	G	4: 47,473,974	S105P	probably benign	Het
Amph	A	G	13: 19,104,345	T335A	probably damaging	Het
Ank2	C	T	3: 126,962,401	V1056M	probably damaging	Het
Apoh	A	G	11: 108,407,378	D168G	probably benign	Het
Arfgef3	C	T	10: 18,589,706	A2130T	probably damaging	Het
Arhgap30	A	G	1: 171,403,329	D218G	probably benign	Het
Ascc3	C	T	10: 50,823,798	P1906S	probably damaging	Het
Atp11b	T	G	3: 35,807,008		probably null	Het
B4galnt2	A	G	11: 95,868,429	V343A	probably damaging	Het
Barhl1	T	C	2: 28,909,773	Y280C	probably damaging	Het
Bcar1	A	T	8: 111,721,037	Y103N	probably damaging	Het
Bid	A	G	6: 120,895,746	I150T	probably benign	Het
Ccdc171	T	C	4: 83,549,639	S74P	probably damaging	Het
Ccni	A	T	5: 93,188,254		probably null	Het
Cct8l1	A	G	5: 25,516,893	E202G	probably benign	Het
Cd200r3	A	G	16: 44,954,259	K212E	probably benign	Het
Cdh19	A	G	1: 110,889,964	S683P	probably damaging	Het
Ces2b	A	T	8: 104,832,781	H93L	probably benign	Het
Clec4a1	G	A	6: 122,930,695	C114Y	probably damaging	Het
Dcc	G	T	18: 71,542,249	S636*	probably null	Het
Dcdc2c	T	C	12: 28,530,473	D187G	possibly damaging	Het
Dgkb	G	T	12: 38,114,658	E150*	probably null	Het
Dhx30	A	G	9: 110,085,961	L884P	probably damaging	Het
Dmwd	T	G	7: 19,081,303		probably null	Het
Dnah17	T	A	11: 118,042,154	N3593Y	probably damaging	Het
Dnm2	G	A	9: 21,481,337	S447N	probably benign	Het
Elk4	G	A	1: 132,017,681	G99D	probably damaging	Het
Entpd1	A	T	19: 40,739,521		probably benign	Het
Fam114a1	T	A	5: 64,979,727	D4E	probably damaging	Het
Fam160b1	T	C	19: 57,378,637	V204A	probably benign	Het
Fam166b	T	A	4: 43,427,514	Q270L	possibly damaging	Het
Fbln2	A	G	6: 91,264,699	D754G	probably damaging	Het
Foxred2	T	C	15: 77,955,835	N85S	probably damaging	Het
Fut9	A	G	4: 25,799,591		probably benign	Het
Gm13023	T	C	4: 143,793,837	V53A	possibly damaging	Het
Gm13762	T	A	2: 88,973,490	I134F	probably damaging	Het
Gm14124	C	T	2: 150,268,760	H457Y	unknown	Het
Gm1818	G	A	12: 48,559,824		noncoding transcript	Het
Gm4894	C	A	9: 49,278,700	Q92K	unknown	Het
Gpx2	T	C	12: 76,792,800	I141M	probably benign	Het
Gusb	T	C	5: 129,995,485	T476A	probably damaging	Het
Hmmr	G	A	11: 40,721,840	T180I	possibly damaging	Het
Itgbl1	T	C	14: 123,973,368	Y493H	probably benign	Het
Klhdc9	G	T	1: 171,360,383	C93*	probably null	Het
Lpar3	A	G	3: 146,284,751	K275E	probably damaging	Het
Lrp1b	A	G	2: 40,802,885		probably null	Het
Lrrc63	C	T	14: 75,084,949	G572S	probably damaging	Het
Mapk11	A	T	15: 89,146,482	D98E	probably benign	Het
Net1	G	A	13: 3,884,905	R374W	probably damaging	Het
Nlrp4g	T	A	9: 124,354,005		noncoding transcript	Het
Nrap	T	A	19: 56,347,220	Y923F	probably damaging	Het
Olfr53	T	A	7: 140,652,621	M214K	probably benign	Het
Olfr811	A	T	10: 129,802,063	V154E	probably benign	Het
Plxnc1	A	G	10: 94,841,473	V964A	probably damaging	Het
Pmfbp1	A	G	8: 109,535,866	I731V	probably benign	Het
Polq	T	A	16: 37,027,912	S294T	probably benign	Het
Pomgnt2	T	C	9: 121,982,554	D387G	probably benign	Het
Prmt2	G	A	10: 76,221,008	T227I	probably damaging	Het
Psmd1	T	A	1: 86,083,225	F341I	probably damaging	Het
Ptpn23	T	C	9: 110,392,738	M127V	probably benign	Het
Ptprc	A	G	1: 138,089,500	F483L	probably damaging	Het
Rab35	A	C	5: 115,640,088	I38L	probably damaging	Het
Rapgef6	A	G	11: 54,657,317	T486A	probably damaging	Het
Rgl3	A	T	9: 21,987,708	C68*	probably null	Het
Rilpl1	T	C	5: 124,515,531	E189G	possibly damaging	Het
Rnf217	T	C	10: 31,517,524	I354V	probably benign	Het
Rspo3	T	C	10: 29,506,528	D50G	probably damaging	Het
Sbno1	A	G	5: 124,374,609	S1366P	possibly damaging	Het
Sema3c	A	G	5: 17,694,686	D392G	probably benign	Het
Serpinb9e	A	T	13: 33,252,952	Y85F	probably benign	Het
Shprh	C	T	10: 11,157,119	T283I	probably benign	Het
Sipa1l1	T	C	12: 82,341,329	S110P	probably benign	Het
Slc16a12	T	A	19: 34,675,243	I168F	probably damaging	Het
Slc23a3	A	G	1: 75,132,624	S221P	probably damaging	Het
Slc35b3	A	T	13: 38,932,911	I366K	possibly damaging	Het
Slc44a5	T	C	3: 154,243,615		probably null	Het
Slc5a12	A	T	2: 110,620,408	D316V	probably damaging	Het
Ssr3	A	G	3: 65,392,453	S29P	probably damaging	Het
Them6	A	T	15: 74,721,518	D75V	probably damaging	Het
Tmem159	T	C	7: 120,116,312	S120P	probably damaging	Het
Tom1l2	A	G	11: 60,258,918	S239P	probably damaging	Het
Tspear	A	G	10: 77,875,043	T500A	probably damaging	Het
Tubgcp6	G	A	15: 89,101,549	A1487V	probably damaging	Het
Uba7	G	A	9: 107,978,991	V522I	possibly damaging	Het
Virma	C	A	4: 11,521,147	C901*	probably null	Het
Vmn1r172	A	T	7: 23,659,887	I66F	possibly damaging	Het
Vmn2r82	A	T	10: 79,379,176	Y331F	probably benign	Het
Wdr55	G	A	18: 36,762,398	V143I	probably benign	Het
Zbtb49	A	T	5: 38,213,963	D191E	possibly damaging	Het
Zfhx4	A	G	3: 5,242,011	H99R	probably damaging	Het
Zfp560	C	T	9: 20,347,967	C533Y	probably damaging	Het
Zfp646	C	T	7: 127,879,182	A177V	probably benign	Het
Zfp653	C	T	9: 22,055,778	E604K	probably damaging	Het

Other mutations in Taf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Taf2	APN	15	55071449	critical splice acceptor site	probably null
IGL00475:Taf2	APN	15	55055850	nonsense	probably null
IGL00549:Taf2	APN	15	55031115	missense	probably benign	0.03
IGL00839:Taf2	APN	15	55045778	nonsense	probably null
IGL01089:Taf2	APN	15	55016581	missense	probably benign
IGL01305:Taf2	APN	15	55048274	missense	probably damaging	0.99
IGL01532:Taf2	APN	15	55049486	missense	possibly damaging	0.94
IGL01903:Taf2	APN	15	55060016	missense	probably benign	0.03
IGL02324:Taf2	APN	15	55028376	missense	probably benign
IGL02328:Taf2	APN	15	55028376	missense	probably benign
IGL02405:Taf2	APN	15	55034155	splice site	probably benign
IGL02671:Taf2	APN	15	55034176	missense	probably benign	0.01
IGL02832:Taf2	APN	15	55016563	missense	probably benign	0.01
IGL03105:Taf2	APN	15	55045799	missense	probably benign	0.26
IGL03118:Taf2	APN	15	55052163	missense	probably damaging	1.00
ANU22:Taf2	UTSW	15	55048274	missense	probably damaging	0.99
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0183:Taf2	UTSW	15	55055790	missense	possibly damaging	0.89
R0326:Taf2	UTSW	15	55047460	missense	probably damaging	0.97
R0362:Taf2	UTSW	15	55045929	missense	probably damaging	1.00
R0423:Taf2	UTSW	15	55064682	missense	probably benign	0.02
R0562:Taf2	UTSW	15	55022188	splice site	probably benign
R0609:Taf2	UTSW	15	55060050	missense	probably damaging	1.00
R0655:Taf2	UTSW	15	55038294	missense	probably damaging	1.00
R0689:Taf2	UTSW	15	55063065	missense	possibly damaging	0.60
R0743:Taf2	UTSW	15	55016461	small deletion	probably benign
R0898:Taf2	UTSW	15	55060084	missense	probably damaging	0.97
R0969:Taf2	UTSW	15	55031157	critical splice acceptor site	probably null
R0974:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1160:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R1376:Taf2	UTSW	15	55016461	small deletion	probably benign
R1388:Taf2	UTSW	15	55036625	missense	probably benign	0.00
R1416:Taf2	UTSW	15	55038410	missense	possibly damaging	0.95
R1458:Taf2	UTSW	15	55059915	missense	probably damaging	0.99
R1477:Taf2	UTSW	15	55062172	missense	possibly damaging	0.87
R1755:Taf2	UTSW	15	55016454	missense	probably damaging	1.00
R1766:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R2090:Taf2	UTSW	15	55016486	missense	probably damaging	0.99
R2228:Taf2	UTSW	15	55064646	missense	possibly damaging	0.94
R2519:Taf2	UTSW	15	55052247	missense	probably benign	0.03
R4073:Taf2	UTSW	15	55052237	missense	probably damaging	1.00
R4470:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4471:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4472:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4716:Taf2	UTSW	15	55065968	missense	probably benign	0.02
R5082:Taf2	UTSW	15	55060045	missense	probably benign	0.41
R5335:Taf2	UTSW	15	55045740	missense	probably benign	0.14
R5383:Taf2	UTSW	15	55049419	missense	possibly damaging	0.78
R5771:Taf2	UTSW	15	55059939	missense	probably benign	0.01
R5862:Taf2	UTSW	15	55048323	missense	possibly damaging	0.95
R5873:Taf2	UTSW	15	55038422	missense	probably benign	0.00
R5908:Taf2	UTSW	15	55072006	unclassified	probably benign
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6159:Taf2	UTSW	15	55063044	missense	possibly damaging	0.48
R6568:Taf2	UTSW	15	55064630	missense	probably damaging	1.00
R7094:Taf2	UTSW	15	55060086	missense	probably benign	0.27
R7174:Taf2	UTSW	15	55048739	missense	possibly damaging	0.51
R7241:Taf2	UTSW	15	55062141	missense	probably benign	0.01
R7561:Taf2	UTSW	15	55055833	missense	probably benign	0.16
R7583:Taf2	UTSW	15	55064676	nonsense	probably null
R7818:Taf2	UTSW	15	55065930	missense	probably benign
R7905:Taf2	UTSW	15	55047432	missense	possibly damaging	0.90
R8006:Taf2	UTSW	15	55048701	missense	probably damaging	1.00
R8017:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66
R8019:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66
R8119:Taf2	UTSW	15	55031130	missense	probably benign	0.00
R8127:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8128:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8129:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8278:Taf2	UTSW	15	55065965	nonsense	probably null
R8290:Taf2	UTSW	15	55063020	missense	probably damaging	1.00
R8762:Taf2	UTSW	15	55047453	missense	probably benign	0.16
R8832:Taf2	UTSW	15	55064605	missense	possibly damaging	0.86
R8916:Taf2	UTSW	15	55036535	missense	probably benign	0.26
R8937:Taf2	UTSW	15	55047453	missense	probably benign	0.16
R9006:Taf2	UTSW	15	55045905	missense	possibly damaging	0.94
R9138:Taf2	UTSW	15	55016461	small deletion	probably benign
R9240:Taf2	UTSW	15	55063068	missense	probably null	1.00
R9257:Taf2	UTSW	15	55066013	missense	possibly damaging	0.46
R9485:Taf2	UTSW	15	55048271	missense	probably benign	0.05
R9762:Taf2	UTSW	15	55031044	critical splice donor site	probably null
R9766:Taf2	UTSW	15	55047485	critical splice acceptor site	probably null
R9796:Taf2	UTSW	15	55047436	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGACAAATGTCTTACACAAATCCAAA -3'
(R):5'- ACTGCTTTTCTTTTGGCGACTGTA -3'

Sequencing Primer
(F):5'- TGGCCGGGAACTCACTATGTAG -3'
(R):5'- GGCGACTGTAATGGGTCTATTC -3'

Posted On

2016-04-15