Incidental Mutation 'R4931:Mindy3'
ID380539
Institutional Source Beutler Lab
Gene Symbol Mindy3
Ensembl Gene ENSMUSG00000026767
Gene NameMINDY lysine 48 deubiquitinase 3
Synonyms5830410F13Rik, 2310047O13Rik, 1810041E18Rik, Fam188a
MMRRC Submission 042532-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R4931 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location12347263-12419470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12396213 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 231 (N231K)
Ref Sequence ENSEMBL: ENSMUSP00000028105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028105] [ENSMUST00000124515] [ENSMUST00000124603] [ENSMUST00000129489] [ENSMUST00000129993] [ENSMUST00000144645] [ENSMUST00000151529] [ENSMUST00000154899] [ENSMUST00000155530]
Predicted Effect probably damaging
Transcript: ENSMUST00000028105
AA Change: N231K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028105
Gene: ENSMUSG00000026767
AA Change: N231K

DomainStartEndE-ValueType
DUF4205 9 351 1.48e-165 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124515
SMART Domains Protein: ENSMUSP00000120193
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Blast:DUF4205 9 94 1e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000124603
SMART Domains Protein: ENSMUSP00000117457
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Pfam:DUF4205 11 79 8.3e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000129348
AA Change: N137K
SMART Domains Protein: ENSMUSP00000121265
Gene: ENSMUSG00000026767
AA Change: N137K

DomainStartEndE-ValueType
DUF4205 3 160 3.65e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129489
SMART Domains Protein: ENSMUSP00000122501
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Pfam:DUF4205 11 84 9.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129993
SMART Domains Protein: ENSMUSP00000141479
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Pfam:DUF4205 3 87 1.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137082
Predicted Effect probably benign
Transcript: ENSMUST00000144645
SMART Domains Protein: ENSMUSP00000116836
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Pfam:DUF4205 11 87 3.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153690
Predicted Effect probably benign
Transcript: ENSMUST00000154899
SMART Domains Protein: ENSMUSP00000121476
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
DUF4205 1 110 6.61e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155530
SMART Domains Protein: ENSMUSP00000116939
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
DUF4205 9 135 6.24e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195084
Meta Mutation Damage Score 0.6946 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (78/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a caspase-associated recruitment domain and may function in apoptosis. It has been identified as a tumor suppressor in lung and gastric cancers, and a polymorphism in the gene may be associated with gastric cancer risk. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,938,120 D21G probably benign Het
4930402H24Rik A G 2: 130,741,873 F496L possibly damaging Het
4930562C15Rik T C 16: 4,861,046 L68P possibly damaging Het
Ache A G 5: 137,291,914 I414V probably benign Het
Acy1 G A 9: 106,433,191 H308Y probably damaging Het
AF529169 T C 9: 89,601,652 H564R probably benign Het
Aldh1b1 A C 4: 45,803,661 I400L probably benign Het
Ankrd40 T A 11: 94,334,821 L226Q probably benign Het
B3gnt9 T C 8: 105,254,244 T171A probably benign Het
Ccdc33 T C 9: 58,069,851 Y289C probably damaging Het
Cd209f A T 8: 4,103,688 I187N probably damaging Het
Cers6 T G 2: 69,105,112 S319A probably damaging Het
Chrna4 A G 2: 181,028,872 S364P probably benign Het
Chrnb3 T C 8: 27,394,230 S317P probably damaging Het
Dapk1 T C 13: 60,760,960 V1129A probably benign Het
Dhx9 G A 1: 153,472,673 P302L probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Duox2 T C 2: 122,296,755 N147S probably benign Het
Dytn T G 1: 63,633,678 E522A probably benign Het
E130114P18Rik T C 4: 97,720,287 D27G unknown Het
Egf A G 3: 129,711,468 F118S probably damaging Het
Eif2d T A 1: 131,154,391 F73L probably damaging Het
Eps8l1 A G 7: 4,471,241 E237G possibly damaging Het
Espl1 A G 15: 102,305,730 E664G probably benign Het
Fbrsl1 A T 5: 110,379,029 S373T possibly damaging Het
Fras1 T A 5: 96,636,840 F894Y probably benign Het
Gm12800 T C 4: 101,909,170 V17A possibly damaging Het
Gpatch8 T C 11: 102,481,224 E496G unknown Het
Gucy1a2 A G 9: 3,759,588 K465E probably damaging Het
Igdcc4 A G 9: 65,124,015 T459A possibly damaging Het
Itgad A T 7: 128,204,625 I64F probably damaging Het
Itgb2l T A 16: 96,437,449 N50I probably damaging Het
Kif13a A G 13: 46,809,055 I478T probably damaging Het
Krt31 G A 11: 100,050,157 T109I probably benign Het
Ltbr G T 6: 125,307,474 probably null Het
Magel2 A G 7: 62,380,624 D1092G unknown Het
Mpnd T G 17: 56,012,362 probably benign Het
Mtus2 C T 5: 148,077,416 L340F probably benign Het
Nanog G A 6: 122,707,906 A17T possibly damaging Het
Ndufa9 G T 6: 126,836,320 A181E probably damaging Het
Olfr619 T G 7: 103,604,374 L240R probably benign Het
Olfr869 A T 9: 20,137,562 I149F probably benign Het
Pprc1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 19: 46,071,316 probably benign Het
Prkacb T C 3: 146,747,977 I211V possibly damaging Het
Ptpn14 C G 1: 189,851,277 L774V probably benign Het
Rad1 T C 15: 10,492,762 probably benign Het
Rims1 G T 1: 22,533,947 P391Q probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sf3b3 C T 8: 110,816,329 R832Q probably benign Het
Slc12a2 A G 18: 57,934,963 D975G possibly damaging Het
Slitrk6 A G 14: 110,750,379 L632P probably damaging Het
Spire2 A G 8: 123,368,784 D542G possibly damaging Het
Sppl3 A T 5: 115,082,314 Q95L probably damaging Het
Stat5b C A 11: 100,784,254 E710* probably null Het
Tcl1 G T 12: 105,222,613 H14N probably damaging Het
Ten1 T C 11: 116,205,729 F70L probably benign Het
Tnfrsf13b A T 11: 61,140,937 T35S possibly damaging Het
Tpcn2 G A 7: 145,267,309 P336L probably benign Het
Trf C A 9: 103,228,048 D22Y probably damaging Het
Ttyh1 A G 7: 4,133,944 probably benign Het
Vmn2r103 A T 17: 19,811,769 I602F probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp352 A G 4: 90,224,304 Y227C probably damaging Het
Zfp599 A T 9: 22,258,123 W18R probably damaging Het
Other mutations in Mindy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01452:Mindy3 APN 2 12355272 splice site probably benign
IGL02623:Mindy3 APN 2 12364483 nonsense probably null
R0944:Mindy3 UTSW 2 12396182 missense possibly damaging 0.94
R1275:Mindy3 UTSW 2 12396173 splice site probably null
R2066:Mindy3 UTSW 2 12419249 missense probably damaging 1.00
R2232:Mindy3 UTSW 2 12404045 missense probably benign 0.44
R2357:Mindy3 UTSW 2 12404176 splice site probably benign
R3724:Mindy3 UTSW 2 12355354 missense probably damaging 0.97
R4031:Mindy3 UTSW 2 12401083 splice site probably null
R4089:Mindy3 UTSW 2 12364516 missense probably benign 0.21
R4175:Mindy3 UTSW 2 12405865 missense probably damaging 1.00
R4359:Mindy3 UTSW 2 12396209 missense probably damaging 1.00
R4424:Mindy3 UTSW 2 12348199 missense probably benign 0.00
R4640:Mindy3 UTSW 2 12348163 missense probably benign 0.01
R5926:Mindy3 UTSW 2 12348100 missense probably damaging 1.00
R5966:Mindy3 UTSW 2 12401043 missense probably benign 0.17
R6330:Mindy3 UTSW 2 12356933 missense probably damaging 1.00
R6518:Mindy3 UTSW 2 12382129 missense probably damaging 1.00
R6587:Mindy3 UTSW 2 12348116 nonsense probably null
R6852:Mindy3 UTSW 2 12419252 start codon destroyed possibly damaging 0.53
R6961:Mindy3 UTSW 2 12396178 critical splice donor site probably null
R7103:Mindy3 UTSW 2 12401074 missense possibly damaging 0.95
R7624:Mindy3 UTSW 2 12419189 missense probably benign 0.00
R7661:Mindy3 UTSW 2 12397517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTGAAACCCAAGATGGCTTCC -3'
(R):5'- TCTCACTAAGGCCGGACATG -3'

Sequencing Primer
(F):5'- ACCTGCACTTAGTATTATGGCATC -3'
(R):5'- CTAAGGCCGGACATGGGAAAG -3'
Posted On2016-04-15