Incidental Mutation 'R4931:Chrna4'
ID380543
Institutional Source Beutler Lab
Gene Symbol Chrna4
Ensembl Gene ENSMUSG00000027577
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 4
Synonymsalpha4 nAChR, Acra-4, a4 nicotinic receptor, Acra4, alpha4-nAChR
MMRRC Submission 042532-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R4931 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181018380-181043546 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181028872 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 364 (S364P)
Ref Sequence ENSEMBL: ENSMUSP00000104479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067120] [ENSMUST00000108851]
Predicted Effect probably benign
Transcript: ENSMUST00000067120
AA Change: S364P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000066338
Gene: ENSMUSG00000027577
AA Change: S364P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 39 245 1.4e-76 PFAM
Pfam:Neur_chan_memb 252 620 1.9e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108851
AA Change: S364P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000104479
Gene: ENSMUSG00000027577
AA Change: S364P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 39 245 8.4e-79 PFAM
Pfam:Neur_chan_memb 252 620 3.3e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135766
SMART Domains Protein: ENSMUSP00000125724
Gene: ENSMUSG00000027577

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 39 130 9.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198922
Meta Mutation Damage Score 0.0970 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (78/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nicotinic acetylcholine receptor, which belongs to a superfamily of ligand-gated ion channels that play a role in fast signal transmission at synapses. These pentameric receptors can bind acetylcholine, which causes an extensive change in conformation that leads to the opening of an ion-conducting channel across the plasma membrane. This protein is an integral membrane receptor subunit that can interact with either nAChR beta-2 or nAChR beta-4 to form a functional receptor. Mutations in this gene cause nocturnal frontal lobe epilepsy type 1. Polymorphisms in this gene that provide protection against nicotine addiction have been described. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Nullizygous mice may show reduced chemically-elicited analgesia, susceptibility to seizures, increased anxiety, and altered behavioral responses to nicotine or a new environment. Homozygotes for any of several knock-in alleles exhibit altered nervous system physiology and/or sensitivity to nicotine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,938,120 D21G probably benign Het
4930402H24Rik A G 2: 130,741,873 F496L possibly damaging Het
4930562C15Rik T C 16: 4,861,046 L68P possibly damaging Het
Ache A G 5: 137,291,914 I414V probably benign Het
Acy1 G A 9: 106,433,191 H308Y probably damaging Het
AF529169 T C 9: 89,601,652 H564R probably benign Het
Aldh1b1 A C 4: 45,803,661 I400L probably benign Het
Ankrd40 T A 11: 94,334,821 L226Q probably benign Het
B3gnt9 T C 8: 105,254,244 T171A probably benign Het
Ccdc33 T C 9: 58,069,851 Y289C probably damaging Het
Cd209f A T 8: 4,103,688 I187N probably damaging Het
Cers6 T G 2: 69,105,112 S319A probably damaging Het
Chrnb3 T C 8: 27,394,230 S317P probably damaging Het
Dapk1 T C 13: 60,760,960 V1129A probably benign Het
Dhx9 G A 1: 153,472,673 P302L probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Duox2 T C 2: 122,296,755 N147S probably benign Het
Dytn T G 1: 63,633,678 E522A probably benign Het
E130114P18Rik T C 4: 97,720,287 D27G unknown Het
Egf A G 3: 129,711,468 F118S probably damaging Het
Eif2d T A 1: 131,154,391 F73L probably damaging Het
Eps8l1 A G 7: 4,471,241 E237G possibly damaging Het
Espl1 A G 15: 102,305,730 E664G probably benign Het
Fbrsl1 A T 5: 110,379,029 S373T possibly damaging Het
Fras1 T A 5: 96,636,840 F894Y probably benign Het
Gm12800 T C 4: 101,909,170 V17A possibly damaging Het
Gpatch8 T C 11: 102,481,224 E496G unknown Het
Gucy1a2 A G 9: 3,759,588 K465E probably damaging Het
Igdcc4 A G 9: 65,124,015 T459A possibly damaging Het
Itgad A T 7: 128,204,625 I64F probably damaging Het
Itgb2l T A 16: 96,437,449 N50I probably damaging Het
Kif13a A G 13: 46,809,055 I478T probably damaging Het
Krt31 G A 11: 100,050,157 T109I probably benign Het
Ltbr G T 6: 125,307,474 probably null Het
Magel2 A G 7: 62,380,624 D1092G unknown Het
Mindy3 A T 2: 12,396,213 N231K probably damaging Het
Mpnd T G 17: 56,012,362 probably benign Het
Mtus2 C T 5: 148,077,416 L340F probably benign Het
Nanog G A 6: 122,707,906 A17T possibly damaging Het
Ndufa9 G T 6: 126,836,320 A181E probably damaging Het
Olfr619 T G 7: 103,604,374 L240R probably benign Het
Olfr869 A T 9: 20,137,562 I149F probably benign Het
Pprc1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 19: 46,071,316 probably benign Het
Prkacb T C 3: 146,747,977 I211V possibly damaging Het
Ptpn14 C G 1: 189,851,277 L774V probably benign Het
Rad1 T C 15: 10,492,762 probably benign Het
Rims1 G T 1: 22,533,947 P391Q probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sf3b3 C T 8: 110,816,329 R832Q probably benign Het
Slc12a2 A G 18: 57,934,963 D975G possibly damaging Het
Slitrk6 A G 14: 110,750,379 L632P probably damaging Het
Spire2 A G 8: 123,368,784 D542G possibly damaging Het
Sppl3 A T 5: 115,082,314 Q95L probably damaging Het
Stat5b C A 11: 100,784,254 E710* probably null Het
Tcl1 G T 12: 105,222,613 H14N probably damaging Het
Ten1 T C 11: 116,205,729 F70L probably benign Het
Tnfrsf13b A T 11: 61,140,937 T35S possibly damaging Het
Tpcn2 G A 7: 145,267,309 P336L probably benign Het
Trf C A 9: 103,228,048 D22Y probably damaging Het
Ttyh1 A G 7: 4,133,944 probably benign Het
Vmn2r103 A T 17: 19,811,769 I602F probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp352 A G 4: 90,224,304 Y227C probably damaging Het
Zfp599 A T 9: 22,258,123 W18R probably damaging Het
Other mutations in Chrna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Chrna4 APN 2 181029391 missense probably benign 0.09
IGL00914:Chrna4 APN 2 181029031 missense probably damaging 1.00
IGL01511:Chrna4 APN 2 181028668 missense probably benign 0.13
IGL02517:Chrna4 APN 2 181029133 missense probably benign 0.01
IGL02715:Chrna4 APN 2 181029581 unclassified probably benign
R1168:Chrna4 UTSW 2 181034138 missense possibly damaging 0.61
R1475:Chrna4 UTSW 2 181029379 missense probably benign 0.44
R1572:Chrna4 UTSW 2 181029307 missense possibly damaging 0.95
R4428:Chrna4 UTSW 2 181028620 missense probably damaging 0.99
R4429:Chrna4 UTSW 2 181028620 missense probably damaging 0.99
R4431:Chrna4 UTSW 2 181028620 missense probably damaging 0.99
R4494:Chrna4 UTSW 2 181028488 missense probably damaging 0.98
R4664:Chrna4 UTSW 2 181037493 missense probably damaging 1.00
R4666:Chrna4 UTSW 2 181037493 missense probably damaging 1.00
R5144:Chrna4 UTSW 2 181024830 missense probably damaging 1.00
R5556:Chrna4 UTSW 2 181033980 missense possibly damaging 0.94
R5633:Chrna4 UTSW 2 181029460 missense probably damaging 1.00
R5889:Chrna4 UTSW 2 181028658 missense probably damaging 1.00
R6056:Chrna4 UTSW 2 181029442 missense probably damaging 1.00
R6120:Chrna4 UTSW 2 181024806 missense probably damaging 1.00
R7030:Chrna4 UTSW 2 181029541 missense probably damaging 1.00
R7352:Chrna4 UTSW 2 181037474 missense probably damaging 0.97
R7694:Chrna4 UTSW 2 181018593 missense
Z1177:Chrna4 UTSW 2 181024813 missense probably damaging 1.00
Z1177:Chrna4 UTSW 2 181028285 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TCAAGTCAGGGACCTTGTGG -3'
(R):5'- ATCACCGAGATCATCCCGTC -3'

Sequencing Primer
(F):5'- CATGTAGGCTGGGTCTCGAC -3'
(R):5'- GAGATCATCCCGTCCACCTCG -3'
Posted On2016-04-15