Incidental Mutation 'R4931:Prkacb'
ID380545
Institutional Source Beutler Lab
Gene Symbol Prkacb
Ensembl Gene ENSMUSG00000005034
Gene Nameprotein kinase, cAMP dependent, catalytic, beta
SynonymscAMP-dependent protein kinase C beta, Pkacb
MMRRC Submission 042532-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.622) question?
Stock #R4931 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location146729574-146812990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146747977 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 211 (I211V)
Ref Sequence ENSEMBL: ENSMUSP00000005164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005164] [ENSMUST00000102515] [ENSMUST00000106137] [ENSMUST00000106138] [ENSMUST00000197616] [ENSMUST00000199722]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005164
AA Change: I211V

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000005164
Gene: ENSMUSG00000005034
AA Change: I211V

DomainStartEndE-ValueType
S_TKc 91 345 1.07e-105 SMART
S_TK_X 346 398 2.47e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102515
AA Change: I164V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099573
Gene: ENSMUSG00000005034
AA Change: I164V

DomainStartEndE-ValueType
S_TKc 44 298 5.3e-108 SMART
S_TK_X 299 344 2.1e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106137
AA Change: I151V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101743
Gene: ENSMUSG00000005034
AA Change: I151V

DomainStartEndE-ValueType
S_TKc 31 285 1.07e-105 SMART
S_TK_X 286 338 2.47e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106138
AA Change: I152V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101744
Gene: ENSMUSG00000005034
AA Change: I152V

DomainStartEndE-ValueType
S_TKc 32 286 1.07e-105 SMART
S_TK_X 287 339 2.47e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144369
Predicted Effect probably benign
Transcript: ENSMUST00000197616
AA Change: I189V

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000142490
Gene: ENSMUSG00000005034
AA Change: I189V

DomainStartEndE-ValueType
Pfam:Pkinase 69 189 4.6e-27 PFAM
Pfam:Pkinase_Tyr 69 189 1.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199722
AA Change: I106V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143303
Gene: ENSMUSG00000005034
AA Change: I106V

DomainStartEndE-ValueType
STYKc 1 106 1.5e-6 SMART
Meta Mutation Damage Score 0.0793 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (78/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. The encoded protein is a catalytic subunit of cAMP (cyclic AMP)-dependent protein kinase, which mediates signalling though cAMP. cAMP signaling is important to a number of processes, including cell proliferaton and differentiation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygotes for a targeted null mutation eliminating the Cbeta1 subunit exhibit impaired hippocampal plasticity, including failure of low frequency stimulation to produce lasting depression and the elimination of mossy fiber long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,938,120 D21G probably benign Het
4930402H24Rik A G 2: 130,741,873 F496L possibly damaging Het
4930562C15Rik T C 16: 4,861,046 L68P possibly damaging Het
Ache A G 5: 137,291,914 I414V probably benign Het
Acy1 G A 9: 106,433,191 H308Y probably damaging Het
AF529169 T C 9: 89,601,652 H564R probably benign Het
Aldh1b1 A C 4: 45,803,661 I400L probably benign Het
Ankrd40 T A 11: 94,334,821 L226Q probably benign Het
B3gnt9 T C 8: 105,254,244 T171A probably benign Het
Ccdc33 T C 9: 58,069,851 Y289C probably damaging Het
Cd209f A T 8: 4,103,688 I187N probably damaging Het
Cers6 T G 2: 69,105,112 S319A probably damaging Het
Chrna4 A G 2: 181,028,872 S364P probably benign Het
Chrnb3 T C 8: 27,394,230 S317P probably damaging Het
Dapk1 T C 13: 60,760,960 V1129A probably benign Het
Dhx9 G A 1: 153,472,673 P302L probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Duox2 T C 2: 122,296,755 N147S probably benign Het
Dytn T G 1: 63,633,678 E522A probably benign Het
E130114P18Rik T C 4: 97,720,287 D27G unknown Het
Egf A G 3: 129,711,468 F118S probably damaging Het
Eif2d T A 1: 131,154,391 F73L probably damaging Het
Eps8l1 A G 7: 4,471,241 E237G possibly damaging Het
Espl1 A G 15: 102,305,730 E664G probably benign Het
Fbrsl1 A T 5: 110,379,029 S373T possibly damaging Het
Fras1 T A 5: 96,636,840 F894Y probably benign Het
Gm12800 T C 4: 101,909,170 V17A possibly damaging Het
Gpatch8 T C 11: 102,481,224 E496G unknown Het
Gucy1a2 A G 9: 3,759,588 K465E probably damaging Het
Igdcc4 A G 9: 65,124,015 T459A possibly damaging Het
Itgad A T 7: 128,204,625 I64F probably damaging Het
Itgb2l T A 16: 96,437,449 N50I probably damaging Het
Kif13a A G 13: 46,809,055 I478T probably damaging Het
Krt31 G A 11: 100,050,157 T109I probably benign Het
Ltbr G T 6: 125,307,474 probably null Het
Magel2 A G 7: 62,380,624 D1092G unknown Het
Mindy3 A T 2: 12,396,213 N231K probably damaging Het
Mpnd T G 17: 56,012,362 probably benign Het
Mtus2 C T 5: 148,077,416 L340F probably benign Het
Nanog G A 6: 122,707,906 A17T possibly damaging Het
Ndufa9 G T 6: 126,836,320 A181E probably damaging Het
Olfr619 T G 7: 103,604,374 L240R probably benign Het
Olfr869 A T 9: 20,137,562 I149F probably benign Het
Pprc1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 19: 46,071,316 probably benign Het
Ptpn14 C G 1: 189,851,277 L774V probably benign Het
Rad1 T C 15: 10,492,762 probably benign Het
Rims1 G T 1: 22,533,947 P391Q probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sf3b3 C T 8: 110,816,329 R832Q probably benign Het
Slc12a2 A G 18: 57,934,963 D975G possibly damaging Het
Slitrk6 A G 14: 110,750,379 L632P probably damaging Het
Spire2 A G 8: 123,368,784 D542G possibly damaging Het
Sppl3 A T 5: 115,082,314 Q95L probably damaging Het
Stat5b C A 11: 100,784,254 E710* probably null Het
Tcl1 G T 12: 105,222,613 H14N probably damaging Het
Ten1 T C 11: 116,205,729 F70L probably benign Het
Tnfrsf13b A T 11: 61,140,937 T35S possibly damaging Het
Tpcn2 G A 7: 145,267,309 P336L probably benign Het
Trf C A 9: 103,228,048 D22Y probably damaging Het
Ttyh1 A G 7: 4,133,944 probably benign Het
Vmn2r103 A T 17: 19,811,769 I602F probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp352 A G 4: 90,224,304 Y227C probably damaging Het
Zfp599 A T 9: 22,258,123 W18R probably damaging Het
Other mutations in Prkacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Prkacb APN 3 146748042 missense probably benign 0.01
IGL01330:Prkacb APN 3 146751511 missense probably damaging 1.00
IGL01419:Prkacb APN 3 146755693 start codon destroyed probably null 0.49
IGL02533:Prkacb APN 3 146732696 missense possibly damaging 0.64
PIT4445001:Prkacb UTSW 3 146755691 missense probably benign 0.13
R0666:Prkacb UTSW 3 146751518 missense probably damaging 0.99
R2169:Prkacb UTSW 3 146746683 unclassified probably null
R4559:Prkacb UTSW 3 146745392 unclassified probably benign
R4613:Prkacb UTSW 3 146737998 missense probably damaging 1.00
R6474:Prkacb UTSW 3 146755724 missense probably damaging 1.00
R6505:Prkacb UTSW 3 146732646 missense probably damaging 1.00
R6654:Prkacb UTSW 3 146750543 missense possibly damaging 0.77
R6864:Prkacb UTSW 3 146745378 missense probably damaging 1.00
R6940:Prkacb UTSW 3 146751499 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTCAGCTCACTTCAAGC -3'
(R):5'- TTTGAATAAGGAAACCCTCTCCCC -3'

Sequencing Primer
(F):5'- CAGCTCACTTCAAGCCTTTTAGATAG -3'
(R):5'- CAAATGCATCCACTCCGTTTG -3'
Posted On2016-04-15