Mutagenetix > Incidental Mutations

Incidental Mutation 'R4931:Prkacb'

380545

Institutional Source

Beutler Lab

Gene Symbol

Prkacb

Ensembl Gene

ENSMUSG00000005034

Gene Name

protein kinase, cAMP dependent, catalytic, beta

Synonyms

cAMP-dependent protein kinase C beta, Pkacb

MMRRC Submission

042532-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.622) question?

Stock #

R4931 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

146729574-146812990 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 146747977 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 211 (I211V)

Ref Sequence

ENSEMBL: ENSMUSP00000005164 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005164] [ENSMUST00000102515] [ENSMUST00000106137] [ENSMUST00000106138] [ENSMUST00000197616] [ENSMUST00000199722]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000005164
AA Change: I211V

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000005164
Gene: ENSMUSG00000005034
AA Change: I211V

Domain	Start	End	E-Value	Type
S_TKc	91	345	1.07e-105	SMART
S_TK_X	346	398	2.47e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102515
AA Change: I164V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000099573
Gene: ENSMUSG00000005034
AA Change: I164V

Domain	Start	End	E-Value	Type
S_TKc	44	298	5.3e-108	SMART
S_TK_X	299	344	2.1e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106137
AA Change: I151V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000101743
Gene: ENSMUSG00000005034
AA Change: I151V

Domain	Start	End	E-Value	Type
S_TKc	31	285	1.07e-105	SMART
S_TK_X	286	338	2.47e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106138
AA Change: I152V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000101744
Gene: ENSMUSG00000005034
AA Change: I152V

Domain	Start	End	E-Value	Type
S_TKc	32	286	1.07e-105	SMART
S_TK_X	287	339	2.47e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144369

Predicted Effect

probably benign
Transcript: ENSMUST00000197616
AA Change: I189V

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000142490
Gene: ENSMUSG00000005034
AA Change: I189V

Domain	Start	End	E-Value	Type
Pfam:Pkinase	69	189	4.6e-27	PFAM
Pfam:Pkinase_Tyr	69	189	1.1e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000199722
AA Change: I106V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000143303
Gene: ENSMUSG00000005034
AA Change: I106V

Domain	Start	End	E-Value	Type
STYKc	1	106	1.5e-6	SMART

Meta Mutation Damage Score

0.0793

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.7%

Validation Efficiency

95% (78/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. The encoded protein is a catalytic subunit of cAMP (cyclic AMP)-dependent protein kinase, which mediates signalling though cAMP. cAMP signaling is important to a number of processes, including cell proliferaton and differentiation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygotes for a targeted null mutation eliminating the Cbeta1 subunit exhibit impaired hippocampal plasticity, including failure of low frequency stimulation to produce lasting depression and the elimination of mossy fiber long term potentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410004B18Rik	A	G	3: 145,938,120	D21G	probably benign	Het
4930402H24Rik	A	G	2: 130,741,873	F496L	possibly damaging	Het
4930562C15Rik	T	C	16: 4,861,046	L68P	possibly damaging	Het
Ache	A	G	5: 137,291,914	I414V	probably benign	Het
Acy1	G	A	9: 106,433,191	H308Y	probably damaging	Het
AF529169	T	C	9: 89,601,652	H564R	probably benign	Het
Aldh1b1	A	C	4: 45,803,661	I400L	probably benign	Het
Ankrd40	T	A	11: 94,334,821	L226Q	probably benign	Het
B3gnt9	T	C	8: 105,254,244	T171A	probably benign	Het
Ccdc33	T	C	9: 58,069,851	Y289C	probably damaging	Het
Cd209f	A	T	8: 4,103,688	I187N	probably damaging	Het
Cers6	T	G	2: 69,105,112	S319A	probably damaging	Het
Chrna4	A	G	2: 181,028,872	S364P	probably benign	Het
Chrnb3	T	C	8: 27,394,230	S317P	probably damaging	Het
Dapk1	T	C	13: 60,760,960	V1129A	probably benign	Het
Dhx9	G	A	1: 153,472,673	P302L	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Duox2	T	C	2: 122,296,755	N147S	probably benign	Het
Dytn	T	G	1: 63,633,678	E522A	probably benign	Het
E130114P18Rik	T	C	4: 97,720,287	D27G	unknown	Het
Egf	A	G	3: 129,711,468	F118S	probably damaging	Het
Eif2d	T	A	1: 131,154,391	F73L	probably damaging	Het
Eps8l1	A	G	7: 4,471,241	E237G	possibly damaging	Het
Espl1	A	G	15: 102,305,730	E664G	probably benign	Het
Fbrsl1	A	T	5: 110,379,029	S373T	possibly damaging	Het
Fras1	T	A	5: 96,636,840	F894Y	probably benign	Het
Gm12800	T	C	4: 101,909,170	V17A	possibly damaging	Het
Gpatch8	T	C	11: 102,481,224	E496G	unknown	Het
Gucy1a2	A	G	9: 3,759,588	K465E	probably damaging	Het
Igdcc4	A	G	9: 65,124,015	T459A	possibly damaging	Het
Itgad	A	T	7: 128,204,625	I64F	probably damaging	Het
Itgb2l	T	A	16: 96,437,449	N50I	probably damaging	Het
Kif13a	A	G	13: 46,809,055	I478T	probably damaging	Het
Krt31	G	A	11: 100,050,157	T109I	probably benign	Het
Ltbr	G	T	6: 125,307,474		probably null	Het
Magel2	A	G	7: 62,380,624	D1092G	unknown	Het
Mindy3	A	T	2: 12,396,213	N231K	probably damaging	Het
Mpnd	T	G	17: 56,012,362		probably benign	Het
Mtus2	C	T	5: 148,077,416	L340F	probably benign	Het
Nanog	G	A	6: 122,707,906	A17T	possibly damaging	Het
Ndufa9	G	T	6: 126,836,320	A181E	probably damaging	Het
Olfr619	T	G	7: 103,604,374	L240R	probably benign	Het
Olfr869	A	T	9: 20,137,562	I149F	probably benign	Het
Pprc1	ATCCTCCTCCTCCTCCTCCTC	ATCCTCCTCCTCCTCCTC	19: 46,071,316		probably benign	Het
Ptpn14	C	G	1: 189,851,277	L774V	probably benign	Het
Rad1	T	C	15: 10,492,762		probably benign	Het
Rims1	G	T	1: 22,533,947	P391Q	probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Sf3b3	C	T	8: 110,816,329	R832Q	probably benign	Het
Slc12a2	A	G	18: 57,934,963	D975G	possibly damaging	Het
Slitrk6	A	G	14: 110,750,379	L632P	probably damaging	Het
Spire2	A	G	8: 123,368,784	D542G	possibly damaging	Het
Sppl3	A	T	5: 115,082,314	Q95L	probably damaging	Het
Stat5b	C	A	11: 100,784,254	E710*	probably null	Het
Tcl1	G	T	12: 105,222,613	H14N	probably damaging	Het
Ten1	T	C	11: 116,205,729	F70L	probably benign	Het
Tnfrsf13b	A	T	11: 61,140,937	T35S	possibly damaging	Het
Tpcn2	G	A	7: 145,267,309	P336L	probably benign	Het
Trf	C	A	9: 103,228,048	D22Y	probably damaging	Het
Ttyh1	A	G	7: 4,133,944		probably benign	Het
Vmn2r103	A	T	17: 19,811,769	I602F	probably benign	Het
Zfp296	G	T	7: 19,579,712	C164F	possibly damaging	Het
Zfp352	A	G	4: 90,224,304	Y227C	probably damaging	Het
Zfp599	A	T	9: 22,258,123	W18R	probably damaging	Het

Other mutations in Prkacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00925:Prkacb	APN	3	146748042	missense	probably benign	0.01
IGL01330:Prkacb	APN	3	146751511	missense	probably damaging	1.00
IGL01419:Prkacb	APN	3	146755693	start codon destroyed	probably null	0.49
IGL02533:Prkacb	APN	3	146732696	missense	possibly damaging	0.64
PIT4445001:Prkacb	UTSW	3	146755691	missense	probably benign	0.13
R0666:Prkacb	UTSW	3	146751518	missense	probably damaging	0.99
R2169:Prkacb	UTSW	3	146746683	unclassified	probably null
R4559:Prkacb	UTSW	3	146745392	unclassified	probably benign
R4613:Prkacb	UTSW	3	146737998	missense	probably damaging	1.00
R6474:Prkacb	UTSW	3	146755724	missense	probably damaging	1.00
R6505:Prkacb	UTSW	3	146732646	missense	probably damaging	1.00
R6654:Prkacb	UTSW	3	146750543	missense	possibly damaging	0.77
R6864:Prkacb	UTSW	3	146745378	missense	probably damaging	1.00
R6940:Prkacb	UTSW	3	146751499	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGTCAGCTCACTTCAAGC -3'
(R):5'- TTTGAATAAGGAAACCCTCTCCCC -3'

Sequencing Primer
(F):5'- CAGCTCACTTCAAGCCTTTTAGATAG -3'
(R):5'- CAAATGCATCCACTCCGTTTG -3'

Posted On

2016-04-15