Mutagenetix > Incidental Mutations

Incidental Mutation 'R0399:Hook2'

38056

Institutional Source

Beutler Lab

Gene Symbol

Hook2

Ensembl Gene

ENSMUSG00000052566

Gene Name

hook microtubule tethering protein 2

Synonyms

MMRRC Submission

038604-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.248) question?

Stock #

R0399 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84990603-85003349 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 84993567 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064495] [ENSMUST00000209764] [ENSMUST00000210326]

Predicted Effect

probably benign
Transcript: ENSMUST00000064495

SMART Domains

Protein: ENSMUSP00000067752
Gene: ENSMUSG00000052566

Domain	Start	End	E-Value	Type
Pfam:HOOK	8	703	2.3e-277	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209652

Predicted Effect

probably benign
Transcript: ENSMUST00000209764

Predicted Effect

probably benign
Transcript: ENSMUST00000210326

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.4%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,750,959		probably benign	Het
6030452D12Rik	T	C	8: 106,504,542	M120T	unknown	Het
Actr1a	A	T	19: 46,385,011		probably null	Het
AI314180	T	C	4: 58,827,047	T1029A	possibly damaging	Het
Anapc5	A	T	5: 122,791,753	V555D	probably damaging	Het
Aox1	A	G	1: 58,068,849		probably null	Het
Arhgap30	A	G	1: 171,404,816	E343G	probably damaging	Het
Asap2	C	T	12: 21,217,997	T291I	possibly damaging	Het
Atp5a1	T	A	18: 77,781,836	Y439*	probably null	Het
Auts2	A	T	5: 131,440,524	S428T	probably benign	Het
B3gnt7	T	A	1: 86,305,711	C109*	probably null	Het
C4b	C	A	17: 34,728,869	Q1657H	probably damaging	Het
Cadm2	A	T	16: 66,747,339	L268*	probably null	Het
Cep290	G	A	10: 100,554,400		probably benign	Het
Cep68	T	G	11: 20,230,571	I687L	probably benign	Het
Chd6	T	A	2: 161,052,688	D84V	probably damaging	Het
Clpx	A	G	9: 65,322,769	T514A	probably benign	Het
Cox18	A	T	5: 90,215,028	C324S	probably benign	Het
Cryzl2	T	C	1: 157,462,016	Y75H	probably damaging	Het
Cxcr6	C	T	9: 123,810,951	A339V	possibly damaging	Het
Dock1	T	C	7: 135,163,442	L1721P	probably benign	Het
Dstyk	T	C	1: 132,453,080		probably benign	Het
Ehf	A	G	2: 103,266,870	Y246H	probably damaging	Het
Epas1	T	C	17: 86,805,193	V73A	probably benign	Het
Filip1	A	G	9: 79,818,310	I1009T	possibly damaging	Het
Glis3	A	T	19: 28,298,768		probably benign	Het
Gm17333	A	T	16: 77,852,790		noncoding transcript	Het
Gpc1	G	A	1: 92,857,309	R358H	possibly damaging	Het
Gpr155	A	T	2: 73,370,002	I387N	possibly damaging	Het
Gria1	A	G	11: 57,186,027	D83G	probably damaging	Het
Grid2	A	G	6: 64,666,052	I933V	probably benign	Het
Hhatl	C	T	9: 121,788,762	A254T	probably benign	Het
Ift140	T	A	17: 25,050,340	S656R	possibly damaging	Het
Il11ra1	A	T	4: 41,766,185	T241S	probably benign	Het
Kank1	A	G	19: 25,411,242	I760V	probably benign	Het
Kansl1	T	C	11: 104,424,132	E360G	possibly damaging	Het
Klf9	A	T	19: 23,142,082	S110C	probably damaging	Het
Klhl31	A	G	9: 77,650,653	N217S	probably benign	Het
Lct	T	C	1: 128,300,525	Y1077C	probably damaging	Het
Lrrc49	A	T	9: 60,610,246		probably benign	Het
Lrrn1	T	A	6: 107,569,120	H626Q	probably benign	Het
Mmp28	A	T	11: 83,451,732	L40Q	probably damaging	Het
Mroh1	C	T	15: 76,452,099	A1530V	probably benign	Het
Myo1e	A	G	9: 70,301,793		probably benign	Het
Naa25	A	T	5: 121,435,490	M761L	probably benign	Het
Ncln	G	A	10: 81,488,297	A465V	probably damaging	Het
Nktr	A	G	9: 121,731,484	N98S	probably damaging	Het
Olfr1012	T	C	2: 85,759,904	I157M	possibly damaging	Het
Olfr215	C	A	6: 116,582,781	S55I	probably benign	Het
Olfr651	T	A	7: 104,553,369	V150E	probably benign	Het
Olfr76	G	C	19: 12,120,370	A114G	possibly damaging	Het
Olfr878	G	T	9: 37,919,553	A304S	possibly damaging	Het
Pacsin2	T	C	15: 83,386,782	Y222C	probably damaging	Het
Pcdhb15	C	T	18: 37,474,168	T151M	possibly damaging	Het
Plcz1	C	A	6: 140,023,230	V161L	possibly damaging	Het
Ppp6c	G	A	2: 39,200,124		probably benign	Het
Rhbdf2	T	A	11: 116,603,992	Y286F	probably benign	Het
Rtn3	A	T	19: 7,457,876	D231E	probably damaging	Het
Slc35c2	A	C	2: 165,280,895	Y156*	probably null	Het
Spata46	A	G	1: 170,311,537	D35G	probably damaging	Het
Tmed3	A	G	9: 89,702,873	F110L	possibly damaging	Het
Tmem104	T	G	11: 115,201,308		probably benign	Het
Tpbg	T	A	9: 85,844,938	V320E	possibly damaging	Het
Trib2	T	C	12: 15,793,663	D190G	probably damaging	Het
Tspan2	A	G	3: 102,759,385	T26A	probably damaging	Het
Usp17lb	A	C	7: 104,841,151	Y190D	possibly damaging	Het
Utp18	C	T	11: 93,880,147		probably benign	Het
Utp20	A	T	10: 88,820,979	D121E	probably damaging	Het
Vmn1r80	T	A	7: 12,193,317	M118K	possibly damaging	Het
Vmn1r84	T	C	7: 12,361,867	S300G	probably benign	Het

Other mutations in Hook2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00921:Hook2	APN	8	85002497	unclassified	probably benign
IGL01161:Hook2	APN	8	84994931	missense	probably benign	0.05
IGL01535:Hook2	APN	8	85002989	missense	probably benign	0.00
IGL01668:Hook2	APN	8	84993578	missense	possibly damaging	0.88
IGL01749:Hook2	APN	8	84993236	critical splice donor site	probably null
IGL01750:Hook2	APN	8	84993236	critical splice donor site	probably null
IGL01753:Hook2	APN	8	84993236	critical splice donor site	probably null
IGL01900:Hook2	APN	8	85001311	unclassified	probably benign
IGL02157:Hook2	APN	8	85001150	unclassified	probably benign
IGL02175:Hook2	APN	8	84991402	missense	probably damaging	1.00
IGL02350:Hook2	APN	8	84994985	nonsense	probably null
IGL02357:Hook2	APN	8	84994985	nonsense	probably null
IGL03377:Hook2	APN	8	85001335	nonsense	probably null
R1133:Hook2	UTSW	8	84995804	missense	probably damaging	1.00
R2087:Hook2	UTSW	8	85002691	missense	probably damaging	0.98
R2277:Hook2	UTSW	8	85002931	nonsense	probably null
R2398:Hook2	UTSW	8	84991299	missense	probably damaging	0.98
R3406:Hook2	UTSW	8	84993984	splice site	probably benign
R4752:Hook2	UTSW	8	85002720	nonsense	probably null
R5014:Hook2	UTSW	8	84991377	missense	probably damaging	1.00
R5068:Hook2	UTSW	8	84993399	missense	possibly damaging	0.81
R5195:Hook2	UTSW	8	84994776	missense	probably damaging	1.00
R5360:Hook2	UTSW	8	85001404	missense	probably damaging	1.00
R5597:Hook2	UTSW	8	84994028	missense	probably benign	0.00
R5614:Hook2	UTSW	8	85002508	missense	probably damaging	1.00
R5843:Hook2	UTSW	8	84991283	missense	probably damaging	0.99
R5931:Hook2	UTSW	8	84995746	nonsense	probably null
R5942:Hook2	UTSW	8	84994780	splice site	probably null
R6120:Hook2	UTSW	8	84998125	missense	probably damaging	1.00
R6167:Hook2	UTSW	8	84995013	missense	probably damaging	1.00
R6936:Hook2	UTSW	8	85002998	missense	probably benign	0.04
R6992:Hook2	UTSW	8	85002556	missense	probably damaging	1.00
R7058:Hook2	UTSW	8	84997411	missense	possibly damaging	0.89
R7101:Hook2	UTSW	8	84997051	missense	probably benign
R7177:Hook2	UTSW	8	84991417	missense	probably benign	0.07
R8072:Hook2	UTSW	8	84994491	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CATCTCCCAGATGTGAGCCTCATTG -3'
(R):5'- GCTGGATTCTGACTGAGAGCTGAC -3'

Sequencing Primer
(F):5'- ATTGGCGAGTTCTCAAATCCTG -3'
(R):5'- GCTGACATATATAAGACCTGGCCTG -3'

Posted On

2013-05-23