Incidental Mutation 'R4931:Olfr869'
ID380571
Institutional Source Beutler Lab
Gene Symbol Olfr869
Ensembl Gene ENSMUSG00000058491
Gene Nameolfactory receptor 869
SynonymsMOR145-6, GA_x6K02T2PVTD-13878275-13879204
MMRRC Submission 042532-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4931 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20129009-20138763 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20137562 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 149 (I149F)
Ref Sequence ENSEMBL: ENSMUSP00000154723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075717] [ENSMUST00000213024]
Predicted Effect probably benign
Transcript: ENSMUST00000075717
AA Change: I149F

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000075135
Gene: ENSMUSG00000049028
AA Change: I149F

DomainStartEndE-ValueType
Pfam:7tm_4 45 321 6.2e-43 PFAM
Pfam:7TM_GPCR_Srsx 49 309 3e-8 PFAM
Pfam:7tm_1 55 304 1.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212969
Predicted Effect probably benign
Transcript: ENSMUST00000213024
AA Change: I149F

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.1638 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (78/82)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,938,120 D21G probably benign Het
4930402H24Rik A G 2: 130,741,873 F496L possibly damaging Het
4930562C15Rik T C 16: 4,861,046 L68P possibly damaging Het
Ache A G 5: 137,291,914 I414V probably benign Het
Acy1 G A 9: 106,433,191 H308Y probably damaging Het
AF529169 T C 9: 89,601,652 H564R probably benign Het
Aldh1b1 A C 4: 45,803,661 I400L probably benign Het
Ankrd40 T A 11: 94,334,821 L226Q probably benign Het
B3gnt9 T C 8: 105,254,244 T171A probably benign Het
Ccdc33 T C 9: 58,069,851 Y289C probably damaging Het
Cd209f A T 8: 4,103,688 I187N probably damaging Het
Cers6 T G 2: 69,105,112 S319A probably damaging Het
Chrna4 A G 2: 181,028,872 S364P probably benign Het
Chrnb3 T C 8: 27,394,230 S317P probably damaging Het
Dapk1 T C 13: 60,760,960 V1129A probably benign Het
Dhx9 G A 1: 153,472,673 P302L probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Duox2 T C 2: 122,296,755 N147S probably benign Het
Dytn T G 1: 63,633,678 E522A probably benign Het
E130114P18Rik T C 4: 97,720,287 D27G unknown Het
Egf A G 3: 129,711,468 F118S probably damaging Het
Eif2d T A 1: 131,154,391 F73L probably damaging Het
Eps8l1 A G 7: 4,471,241 E237G possibly damaging Het
Espl1 A G 15: 102,305,730 E664G probably benign Het
Fbrsl1 A T 5: 110,379,029 S373T possibly damaging Het
Fras1 T A 5: 96,636,840 F894Y probably benign Het
Gm12800 T C 4: 101,909,170 V17A possibly damaging Het
Gpatch8 T C 11: 102,481,224 E496G unknown Het
Gucy1a2 A G 9: 3,759,588 K465E probably damaging Het
Igdcc4 A G 9: 65,124,015 T459A possibly damaging Het
Itgad A T 7: 128,204,625 I64F probably damaging Het
Itgb2l T A 16: 96,437,449 N50I probably damaging Het
Kif13a A G 13: 46,809,055 I478T probably damaging Het
Krt31 G A 11: 100,050,157 T109I probably benign Het
Ltbr G T 6: 125,307,474 probably null Het
Magel2 A G 7: 62,380,624 D1092G unknown Het
Mindy3 A T 2: 12,396,213 N231K probably damaging Het
Mpnd T G 17: 56,012,362 probably benign Het
Mtus2 C T 5: 148,077,416 L340F probably benign Het
Nanog G A 6: 122,707,906 A17T possibly damaging Het
Ndufa9 G T 6: 126,836,320 A181E probably damaging Het
Olfr619 T G 7: 103,604,374 L240R probably benign Het
Pprc1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 19: 46,071,316 probably benign Het
Prkacb T C 3: 146,747,977 I211V possibly damaging Het
Ptpn14 C G 1: 189,851,277 L774V probably benign Het
Rad1 T C 15: 10,492,762 probably benign Het
Rims1 G T 1: 22,533,947 P391Q probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sf3b3 C T 8: 110,816,329 R832Q probably benign Het
Slc12a2 A G 18: 57,934,963 D975G possibly damaging Het
Slitrk6 A G 14: 110,750,379 L632P probably damaging Het
Spire2 A G 8: 123,368,784 D542G possibly damaging Het
Sppl3 A T 5: 115,082,314 Q95L probably damaging Het
Stat5b C A 11: 100,784,254 E710* probably null Het
Tcl1 G T 12: 105,222,613 H14N probably damaging Het
Ten1 T C 11: 116,205,729 F70L probably benign Het
Tnfrsf13b A T 11: 61,140,937 T35S possibly damaging Het
Tpcn2 G A 7: 145,267,309 P336L probably benign Het
Trf C A 9: 103,228,048 D22Y probably damaging Het
Ttyh1 A G 7: 4,133,944 probably benign Het
Vmn2r103 A T 17: 19,811,769 I602F probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp352 A G 4: 90,224,304 Y227C probably damaging Het
Zfp599 A T 9: 22,258,123 W18R probably damaging Het
Other mutations in Olfr869
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Olfr869 APN 9 20137235 missense probably benign
IGL01550:Olfr869 APN 9 20137454 missense probably damaging 0.97
IGL02247:Olfr869 APN 9 20137220 missense probably benign 0.01
IGL02448:Olfr869 APN 9 20137641 nonsense probably null
IGL03076:Olfr869 APN 9 20137727 missense probably benign 0.25
R0045:Olfr869 UTSW 9 20137191 missense probably benign 0.25
R0962:Olfr869 UTSW 9 20137538 missense probably damaging 1.00
R4588:Olfr869 UTSW 9 20138087 makesense probably null
R5030:Olfr869 UTSW 9 20138067 missense probably benign 0.01
R5759:Olfr869 UTSW 9 20137932 missense probably benign 0.12
R5780:Olfr869 UTSW 9 20137497 missense probably damaging 0.98
R6440:Olfr869 UTSW 9 20137194 missense probably damaging 1.00
R6599:Olfr869 UTSW 9 20137943 missense probably damaging 1.00
R6710:Olfr869 UTSW 9 20138082 missense probably benign 0.01
R6953:Olfr869 UTSW 9 20138003 missense probably benign 0.00
R7288:Olfr869 UTSW 9 20137441 nonsense probably null
R7585:Olfr869 UTSW 9 20129011
R7860:Olfr869 UTSW 9 20137575 missense probably benign 0.16
R7943:Olfr869 UTSW 9 20137575 missense probably benign 0.16
R8025:Olfr869 UTSW 9 20137632 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACCTGCTCATCATTCTGGC -3'
(R):5'- GCTTTTGGTGAACATTTCAGAACAG -3'

Sequencing Primer
(F):5'- TGATCTCCACTATAGTCCCAAGGATG -3'
(R):5'- TGGTGAACATTTCAGAACAGTTAAG -3'
Posted On2016-04-15