Mutagenetix > Incidental Mutation

Incidental Mutation 'R4931:Espl1'

380592

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

042532-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4931 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102305730 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 664 (E664G)

Ref Sequence

ENSEMBL: ENSMUSP00000155304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

probably benign
Transcript: ENSMUST00000064924
AA Change: E664G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: E664G

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000229050
AA Change: E664G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230120

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.7%

Validation Efficiency

95% (78/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410004B18Rik	A	G	3: 145,938,120	D21G	probably benign	Het
4930402H24Rik	A	G	2: 130,741,873	F496L	possibly damaging	Het
4930562C15Rik	T	C	16: 4,861,046	L68P	possibly damaging	Het
Ache	A	G	5: 137,291,914	I414V	probably benign	Het
Acy1	G	A	9: 106,433,191	H308Y	probably damaging	Het
AF529169	T	C	9: 89,601,652	H564R	probably benign	Het
Aldh1b1	A	C	4: 45,803,661	I400L	probably benign	Het
Ankrd40	T	A	11: 94,334,821	L226Q	probably benign	Het
B3gnt9	T	C	8: 105,254,244	T171A	probably benign	Het
Ccdc33	T	C	9: 58,069,851	Y289C	probably damaging	Het
Cd209f	A	T	8: 4,103,688	I187N	probably damaging	Het
Cers6	T	G	2: 69,105,112	S319A	probably damaging	Het
Chrna4	A	G	2: 181,028,872	S364P	probably benign	Het
Chrnb3	T	C	8: 27,394,230	S317P	probably damaging	Het
Dapk1	T	C	13: 60,760,960	V1129A	probably benign	Het
Dhx9	G	A	1: 153,472,673	P302L	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Duox2	T	C	2: 122,296,755	N147S	probably benign	Het
Dytn	T	G	1: 63,633,678	E522A	probably benign	Het
E130114P18Rik	T	C	4: 97,720,287	D27G	unknown	Het
Egf	A	G	3: 129,711,468	F118S	probably damaging	Het
Eif2d	T	A	1: 131,154,391	F73L	probably damaging	Het
Eps8l1	A	G	7: 4,471,241	E237G	possibly damaging	Het
Fbrsl1	A	T	5: 110,379,029	S373T	possibly damaging	Het
Fras1	T	A	5: 96,636,840	F894Y	probably benign	Het
Gm12800	T	C	4: 101,909,170	V17A	possibly damaging	Het
Gpatch8	T	C	11: 102,481,224	E496G	unknown	Het
Gucy1a2	A	G	9: 3,759,588	K465E	probably damaging	Het
Igdcc4	A	G	9: 65,124,015	T459A	possibly damaging	Het
Itgad	A	T	7: 128,204,625	I64F	probably damaging	Het
Itgb2l	T	A	16: 96,437,449	N50I	probably damaging	Het
Kif13a	A	G	13: 46,809,055	I478T	probably damaging	Het
Krt31	G	A	11: 100,050,157	T109I	probably benign	Het
Ltbr	G	T	6: 125,307,474		probably null	Het
Magel2	A	G	7: 62,380,624	D1092G	unknown	Het
Mindy3	A	T	2: 12,396,213	N231K	probably damaging	Het
Mpnd	T	G	17: 56,012,362		probably benign	Het
Mtus2	C	T	5: 148,077,416	L340F	probably benign	Het
Nanog	G	A	6: 122,707,906	A17T	possibly damaging	Het
Ndufa9	G	T	6: 126,836,320	A181E	probably damaging	Het
Olfr619	T	G	7: 103,604,374	L240R	probably benign	Het
Olfr869	A	T	9: 20,137,562	I149F	probably benign	Het
Pprc1	ATCCTCCTCCTCCTCCTCCTC	ATCCTCCTCCTCCTCCTC	19: 46,071,316		probably benign	Het
Prkacb	T	C	3: 146,747,977	I211V	possibly damaging	Het
Ptpn14	C	G	1: 189,851,277	L774V	probably benign	Het
Rad1	T	C	15: 10,492,762		probably benign	Het
Rims1	G	T	1: 22,533,947	P391Q	probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Sf3b3	C	T	8: 110,816,329	R832Q	probably benign	Het
Slc12a2	A	G	18: 57,934,963	D975G	possibly damaging	Het
Slitrk6	A	G	14: 110,750,379	L632P	probably damaging	Het
Spire2	A	G	8: 123,368,784	D542G	possibly damaging	Het
Sppl3	A	T	5: 115,082,314	Q95L	probably damaging	Het
Stat5b	C	A	11: 100,784,254	E710*	probably null	Het
Tcl1	G	T	12: 105,222,613	H14N	probably damaging	Het
Ten1	T	C	11: 116,205,729	F70L	probably benign	Het
Tnfrsf13b	A	T	11: 61,140,937	T35S	possibly damaging	Het
Tpcn2	G	A	7: 145,267,309	P336L	probably benign	Het
Trf	C	A	9: 103,228,048	D22Y	probably damaging	Het
Ttyh1	A	G	7: 4,133,944		probably benign	Het
Vmn2r103	A	T	17: 19,811,769	I602F	probably benign	Het
Zfp296	G	T	7: 19,579,712	C164F	possibly damaging	Het
Zfp352	A	G	4: 90,224,304	Y227C	probably damaging	Het
Zfp599	A	T	9: 22,258,123	W18R	probably damaging	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGTGCTCCCTTCATTTTAAGC -3'
(R):5'- ATTCCTCCAAGTTACTAGGGGC -3'

Sequencing Primer
(F):5'- TCACAGGCTGCTTAAATGCTAGG -3'
(R):5'- GATCCCGCTCAATACCCTGG -3'

Posted On

2016-04-15