Incidental Mutation 'R4931:Pprc1'
ID380598
Institutional Source Beutler Lab
Gene Symbol Pprc1
Ensembl Gene ENSMUSG00000055491
Gene Nameperoxisome proliferative activated receptor, gamma, coactivator-related 1
Synonyms
MMRRC Submission 042532-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4931 (G1)
Quality Score107
Status Not validated
Chromosome19
Chromosomal Location46044886-46072915 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) ATCCTCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTC at 46071316 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062322] [ENSMUST00000099392] [ENSMUST00000111899] [ENSMUST00000165017] [ENSMUST00000223728] [ENSMUST00000223741] [ENSMUST00000224490] [ENSMUST00000225780]
Predicted Effect probably benign
Transcript: ENSMUST00000062322
SMART Domains Protein: ENSMUSP00000079389
Gene: ENSMUSG00000055491

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 214 240 N/A INTRINSIC
low complexity region 448 459 N/A INTRINSIC
low complexity region 516 525 N/A INTRINSIC
low complexity region 646 661 N/A INTRINSIC
low complexity region 732 739 N/A INTRINSIC
low complexity region 826 887 N/A INTRINSIC
low complexity region 915 925 N/A INTRINSIC
low complexity region 939 960 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 1020 1033 N/A INTRINSIC
low complexity region 1224 1240 N/A INTRINSIC
low complexity region 1397 1446 N/A INTRINSIC
low complexity region 1453 1504 N/A INTRINSIC
RRM 1526 1597 3.36e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099392
SMART Domains Protein: ENSMUSP00000096990
Gene: ENSMUSG00000055491

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 210 236 N/A INTRINSIC
low complexity region 444 455 N/A INTRINSIC
low complexity region 512 521 N/A INTRINSIC
low complexity region 642 657 N/A INTRINSIC
low complexity region 728 735 N/A INTRINSIC
low complexity region 822 883 N/A INTRINSIC
low complexity region 911 921 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 975 987 N/A INTRINSIC
low complexity region 1016 1029 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111899
SMART Domains Protein: ENSMUSP00000107530
Gene: ENSMUSG00000055491

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 213 239 N/A INTRINSIC
low complexity region 447 458 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 731 738 N/A INTRINSIC
low complexity region 825 886 N/A INTRINSIC
low complexity region 914 924 N/A INTRINSIC
low complexity region 938 959 N/A INTRINSIC
low complexity region 978 990 N/A INTRINSIC
low complexity region 1019 1032 N/A INTRINSIC
low complexity region 1222 1238 N/A INTRINSIC
low complexity region 1395 1444 N/A INTRINSIC
low complexity region 1451 1502 N/A INTRINSIC
RRM 1524 1595 3.36e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153111
Predicted Effect probably benign
Transcript: ENSMUST00000165017
SMART Domains Protein: ENSMUSP00000128331
Gene: ENSMUSG00000015176

DomainStartEndE-ValueType
LisH 10 42 2.3e-2 SMART
low complexity region 76 100 N/A INTRINSIC
low complexity region 123 187 N/A INTRINSIC
low complexity region 189 210 N/A INTRINSIC
low complexity region 224 272 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 329 342 N/A INTRINSIC
low complexity region 353 383 N/A INTRINSIC
low complexity region 429 470 N/A INTRINSIC
low complexity region 472 486 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 509 538 N/A INTRINSIC
low complexity region 558 579 N/A INTRINSIC
Pfam:SRP40_C 627 699 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223683
Predicted Effect probably benign
Transcript: ENSMUST00000223728
Predicted Effect probably benign
Transcript: ENSMUST00000223741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224434
Predicted Effect probably benign
Transcript: ENSMUST00000224490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225758
Predicted Effect probably benign
Transcript: ENSMUST00000225780
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (78/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to PPAR-gamma coactivator 1 (PPARGC1/PGC-1), a protein that can activate mitochondrial biogenesis in part through a direct interaction with nuclear respiratory factor 1 (NRF1). This protein has been shown to interact with NRF1. It is thought to be a functional relative of PPAR-gamma coactivator 1 that activates mitochondrial biogenesis through NRF1 in response to proliferative signals. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit letahlity post-implantation with delayed hatching and disorganized embryo tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,938,120 D21G probably benign Het
4930402H24Rik A G 2: 130,741,873 F496L possibly damaging Het
4930562C15Rik T C 16: 4,861,046 L68P possibly damaging Het
Ache A G 5: 137,291,914 I414V probably benign Het
Acy1 G A 9: 106,433,191 H308Y probably damaging Het
AF529169 T C 9: 89,601,652 H564R probably benign Het
Aldh1b1 A C 4: 45,803,661 I400L probably benign Het
Ankrd40 T A 11: 94,334,821 L226Q probably benign Het
B3gnt9 T C 8: 105,254,244 T171A probably benign Het
Ccdc33 T C 9: 58,069,851 Y289C probably damaging Het
Cd209f A T 8: 4,103,688 I187N probably damaging Het
Cers6 T G 2: 69,105,112 S319A probably damaging Het
Chrna4 A G 2: 181,028,872 S364P probably benign Het
Chrnb3 T C 8: 27,394,230 S317P probably damaging Het
Dapk1 T C 13: 60,760,960 V1129A probably benign Het
Dhx9 G A 1: 153,472,673 P302L probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Duox2 T C 2: 122,296,755 N147S probably benign Het
Dytn T G 1: 63,633,678 E522A probably benign Het
E130114P18Rik T C 4: 97,720,287 D27G unknown Het
Egf A G 3: 129,711,468 F118S probably damaging Het
Eif2d T A 1: 131,154,391 F73L probably damaging Het
Eps8l1 A G 7: 4,471,241 E237G possibly damaging Het
Espl1 A G 15: 102,305,730 E664G probably benign Het
Fbrsl1 A T 5: 110,379,029 S373T possibly damaging Het
Fras1 T A 5: 96,636,840 F894Y probably benign Het
Gm12800 T C 4: 101,909,170 V17A possibly damaging Het
Gpatch8 T C 11: 102,481,224 E496G unknown Het
Gucy1a2 A G 9: 3,759,588 K465E probably damaging Het
Igdcc4 A G 9: 65,124,015 T459A possibly damaging Het
Itgad A T 7: 128,204,625 I64F probably damaging Het
Itgb2l T A 16: 96,437,449 N50I probably damaging Het
Kif13a A G 13: 46,809,055 I478T probably damaging Het
Krt31 G A 11: 100,050,157 T109I probably benign Het
Ltbr G T 6: 125,307,474 probably null Het
Magel2 A G 7: 62,380,624 D1092G unknown Het
Mindy3 A T 2: 12,396,213 N231K probably damaging Het
Mpnd T G 17: 56,012,362 probably benign Het
Mtus2 C T 5: 148,077,416 L340F probably benign Het
Nanog G A 6: 122,707,906 A17T possibly damaging Het
Ndufa9 G T 6: 126,836,320 A181E probably damaging Het
Olfr619 T G 7: 103,604,374 L240R probably benign Het
Olfr869 A T 9: 20,137,562 I149F probably benign Het
Prkacb T C 3: 146,747,977 I211V possibly damaging Het
Ptpn14 C G 1: 189,851,277 L774V probably benign Het
Rad1 T C 15: 10,492,762 probably benign Het
Rims1 G T 1: 22,533,947 P391Q probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sf3b3 C T 8: 110,816,329 R832Q probably benign Het
Slc12a2 A G 18: 57,934,963 D975G possibly damaging Het
Slitrk6 A G 14: 110,750,379 L632P probably damaging Het
Spire2 A G 8: 123,368,784 D542G possibly damaging Het
Sppl3 A T 5: 115,082,314 Q95L probably damaging Het
Stat5b C A 11: 100,784,254 E710* probably null Het
Tcl1 G T 12: 105,222,613 H14N probably damaging Het
Ten1 T C 11: 116,205,729 F70L probably benign Het
Tnfrsf13b A T 11: 61,140,937 T35S possibly damaging Het
Tpcn2 G A 7: 145,267,309 P336L probably benign Het
Trf C A 9: 103,228,048 D22Y probably damaging Het
Ttyh1 A G 7: 4,133,944 probably benign Het
Vmn2r103 A T 17: 19,811,769 I602F probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp352 A G 4: 90,224,304 Y227C probably damaging Het
Zfp599 A T 9: 22,258,123 W18R probably damaging Het
Other mutations in Pprc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Pprc1 APN 19 46062648 missense possibly damaging 0.93
IGL00825:Pprc1 APN 19 46071406 unclassified probably benign
IGL01445:Pprc1 APN 19 46065232 unclassified probably benign
IGL01449:Pprc1 APN 19 46065232 unclassified probably benign
IGL01475:Pprc1 APN 19 46071529 missense probably benign 0.03
IGL01750:Pprc1 APN 19 46071829 unclassified probably benign
IGL01779:Pprc1 APN 19 46062202 missense probably damaging 1.00
IGL01943:Pprc1 APN 19 46064544 unclassified probably benign
IGL02031:Pprc1 APN 19 46072343 unclassified probably benign
IGL02145:Pprc1 APN 19 46064890 unclassified probably benign
IGL02206:Pprc1 APN 19 46071751 missense probably damaging 0.98
IGL02439:Pprc1 APN 19 46072319 missense possibly damaging 0.94
IGL02675:Pprc1 APN 19 46063507 missense probably damaging 1.00
IGL03185:Pprc1 APN 19 46069747 intron probably benign
IGL03325:Pprc1 APN 19 46061509 missense possibly damaging 0.86
R0125:Pprc1 UTSW 19 46069512 intron probably benign
R0388:Pprc1 UTSW 19 46062775 missense possibly damaging 0.85
R0498:Pprc1 UTSW 19 46071568 nonsense probably null
R1129:Pprc1 UTSW 19 46063806 missense probably benign 0.35
R1439:Pprc1 UTSW 19 46063736 missense possibly damaging 0.94
R1536:Pprc1 UTSW 19 46071526 unclassified probably benign
R4551:Pprc1 UTSW 19 46067225 unclassified probably benign
R4698:Pprc1 UTSW 19 46069195 intron probably benign
R4822:Pprc1 UTSW 19 46071356 unclassified probably benign
R4909:Pprc1 UTSW 19 46064319 missense probably damaging 0.99
R5132:Pprc1 UTSW 19 46072682 unclassified probably benign
R5157:Pprc1 UTSW 19 46064758 unclassified probably benign
R5834:Pprc1 UTSW 19 46065220 unclassified probably benign
R5938:Pprc1 UTSW 19 46071316 unclassified probably benign
R5947:Pprc1 UTSW 19 46063672 missense possibly damaging 0.85
R5975:Pprc1 UTSW 19 46065370 unclassified probably benign
R6009:Pprc1 UTSW 19 46071732 missense probably damaging 1.00
R6259:Pprc1 UTSW 19 46064410 missense probably damaging 0.97
R6954:Pprc1 UTSW 19 46064433 missense probably damaging 0.96
R7287:Pprc1 UTSW 19 46071354 missense unknown
R7355:Pprc1 UTSW 19 46065346 missense unknown
R7527:Pprc1 UTSW 19 46069365 missense unknown
R7632:Pprc1 UTSW 19 46072282 missense probably damaging 1.00
R7745:Pprc1 UTSW 19 46065342 missense unknown
R7896:Pprc1 UTSW 19 46061449 missense unknown
R7979:Pprc1 UTSW 19 46061449 missense unknown
Z1177:Pprc1 UTSW 19 46062406 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGGCTCTCCCACTTGTTAC -3'
(R):5'- CATTTGCACGGTAAGAGCTGTAC -3'

Sequencing Primer
(F):5'- CACTTGTTACTTGCAAAGAAAACCTG -3'
(R):5'- CACGGTAAGAGCTGTACCTGAC -3'
Posted On2016-04-15