Incidental Mutation 'R4932:Dph5'
ID 380614
Institutional Source Beutler Lab
Gene Symbol Dph5
Ensembl Gene ENSMUSG00000033554
Gene Name diphthamide biosynthesis 5
Synonyms 2410012M04Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.946) question?
Stock # R4932 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 115681785-115728010 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 115693456 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 125 (M125L)
Ref Sequence ENSEMBL: ENSMUSP00000102114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043342] [ENSMUST00000106505] [ENSMUST00000185098] [ENSMUST00000189799] [ENSMUST00000196804]
AlphaFold Q9CWQ0
Predicted Effect probably benign
Transcript: ENSMUST00000043342
SMART Domains Protein: ENSMUSP00000043730
Gene: ENSMUSG00000033554

DomainStartEndE-ValueType
Pfam:TP_methylase 1 241 1.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106505
AA Change: M125L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102114
Gene: ENSMUSG00000033554
AA Change: M125L

DomainStartEndE-ValueType
Pfam:TP_methylase 1 138 3.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185098
SMART Domains Protein: ENSMUSP00000139249
Gene: ENSMUSG00000033554

DomainStartEndE-ValueType
Pfam:TP_methylase 1 177 4.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189799
SMART Domains Protein: ENSMUSP00000140958
Gene: ENSMUSG00000033554

DomainStartEndE-ValueType
Pfam:TP_methylase 1 241 7.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196804
SMART Domains Protein: ENSMUSP00000142654
Gene: ENSMUSG00000033554

DomainStartEndE-ValueType
Pfam:TP_methylase 1 114 1e-17 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the diphthamide synthesis pathway. Diphthamide is a post-translationally modified histidine residue found only on translation elongation factor 2. It is conserved from archaebacteria to humans, and is targeted by diphtheria toxin and Pseudomonas exotoxin A to halt cellular protein synthesis. The yeast and Chinese hamster homologs of this protein catalyze the trimethylation of the histidine residue on elongation factor 2, resulting in a diphthine moiety that is subsequently amidated to yield diphthamide. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A T 17: 36,270,342 (GRCm39) V616E possibly damaging Het
Adam21 A G 12: 81,605,692 (GRCm39) V690A probably benign Het
Afg3l1 A T 8: 124,228,119 (GRCm39) T635S probably damaging Het
Ahcyl2 T A 6: 29,890,700 (GRCm39) M390K probably benign Het
Ank3 T A 10: 69,734,053 (GRCm39) probably null Het
Antkmt T G 17: 26,010,652 (GRCm39) probably null Het
Arhgef3 A T 14: 27,106,170 (GRCm39) K151N probably damaging Het
Ccr3 T G 9: 123,829,043 (GRCm39) F126C probably damaging Het
Ccser1 A G 6: 61,695,175 (GRCm39) D170G possibly damaging Het
Celsr2 T A 3: 108,310,074 (GRCm39) D1552V probably damaging Het
Cfap69 G A 5: 5,675,820 (GRCm39) L265F probably damaging Het
Chrna9 C T 5: 66,126,533 (GRCm39) R92* probably null Het
Cog3 A T 14: 75,970,394 (GRCm39) V341D probably damaging Het
Csmd1 C A 8: 16,073,779 (GRCm39) R2072L probably damaging Het
Dbf4 G T 5: 8,448,039 (GRCm39) H390Q probably benign Het
Dcaf4 T A 12: 83,579,078 (GRCm39) C166S possibly damaging Het
Dclk3 T A 9: 111,297,110 (GRCm39) L218Q possibly damaging Het
Dip2b T A 15: 100,069,603 (GRCm39) W643R probably damaging Het
Dip2c A G 13: 9,674,008 (GRCm39) K1091E probably damaging Het
Dis3 T A 14: 99,326,340 (GRCm39) H415L probably damaging Het
Dnah7a T A 1: 53,542,737 (GRCm39) I2478F possibly damaging Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Doc2a T C 7: 126,447,752 (GRCm39) probably benign Het
Dst A T 1: 34,267,764 (GRCm39) T5247S possibly damaging Het
Eno4 T G 19: 58,952,889 (GRCm39) V477G possibly damaging Het
Exosc8 T C 3: 54,636,711 (GRCm39) I207V possibly damaging Het
Fat4 T A 3: 39,061,352 (GRCm39) S4312T probably benign Het
Fgfr2 T C 7: 129,843,007 (GRCm39) D126G probably damaging Het
Fgfr4 A G 13: 55,315,983 (GRCm39) T799A unknown Het
Gcn1 A T 5: 115,730,203 (GRCm39) D839V probably benign Het
Gprin3 A G 6: 59,331,158 (GRCm39) V383A probably benign Het
Gpt T C 15: 76,583,040 (GRCm39) V361A probably benign Het
Hepacam G A 9: 37,293,060 (GRCm39) C217Y probably damaging Het
Hsp90aa1 A T 12: 110,660,151 (GRCm39) Y382N probably damaging Het
Htr2a T A 14: 74,879,462 (GRCm39) N30K probably benign Het
Jhy A T 9: 40,872,299 (GRCm39) M70K possibly damaging Het
Lrrc19 T C 4: 94,529,174 (GRCm39) Y36C probably damaging Het
Madcam1 C T 10: 79,501,447 (GRCm39) Q171* probably null Het
Mcm8 G A 2: 132,680,629 (GRCm39) M544I probably benign Het
Mdga1 C T 17: 30,076,580 (GRCm39) G64E probably damaging Het
Mmp3 A G 9: 7,446,994 (GRCm39) D58G probably benign Het
Ms4a10 T C 19: 10,942,132 (GRCm39) Y123C probably damaging Het
Ms4a4d T A 19: 11,535,296 (GRCm39) I198K probably benign Het
Mthfd1l A T 10: 3,930,241 (GRCm39) D112V probably benign Het
N4bp2l2 A C 5: 150,566,606 (GRCm39) S567R probably benign Het
Ndufaf2 A G 13: 108,295,010 (GRCm39) Y32H probably damaging Het
Nup153 T A 13: 46,866,213 (GRCm39) K182* probably null Het
Or4c100 A G 2: 88,356,079 (GRCm39) T51A probably benign Het
Or52p2 A G 7: 102,237,623 (GRCm39) F109S probably damaging Het
Or5p4 T A 7: 107,680,781 (GRCm39) V260E probably damaging Het
Otoa T C 7: 120,754,358 (GRCm39) S928P probably damaging Het
Oxct2a T C 4: 123,216,496 (GRCm39) D295G probably benign Het
P4ha2 C A 11: 54,015,846 (GRCm39) T411K probably benign Het
Plcg2 A T 8: 118,333,822 (GRCm39) Q865L probably benign Het
Prepl G T 17: 85,385,932 (GRCm39) T244K possibly damaging Het
Ptpro A T 6: 137,388,103 (GRCm39) K776* probably null Het
Rc3h2 T C 2: 37,279,844 (GRCm39) K462E possibly damaging Het
Scn10a A G 9: 119,516,940 (GRCm39) probably null Het
Serpinb1c A G 13: 33,066,147 (GRCm39) V266A probably damaging Het
Slc6a20b T A 9: 123,433,861 (GRCm39) N326Y probably damaging Het
Spcs2 C T 7: 99,508,038 (GRCm39) G16D possibly damaging Het
Spns3 T C 11: 72,390,321 (GRCm39) D441G possibly damaging Het
Srsf4 A G 4: 131,618,556 (GRCm39) D49G probably damaging Het
Tec A T 5: 72,917,736 (GRCm39) C494* probably null Het
Tecpr1 A T 5: 144,141,476 (GRCm39) Y798N probably damaging Het
Tex56 A T 13: 35,116,613 (GRCm39) T121S possibly damaging Het
Tmt1a T A 15: 100,202,987 (GRCm39) F87Y probably benign Het
Trim56 C T 5: 137,143,343 (GRCm39) E58K probably damaging Het
Ttn A T 2: 76,626,478 (GRCm39) D13146E probably damaging Het
Ube2q1 A T 3: 89,686,790 (GRCm39) K46* probably null Het
Ucn G T 5: 31,295,842 (GRCm39) T8K probably benign Het
Usp25 T C 16: 76,830,870 (GRCm39) probably null Het
Usp48 A T 4: 137,343,144 (GRCm39) Q430L probably benign Het
Usp48 A T 4: 137,343,145 (GRCm39) probably null Het
Vill A T 9: 118,890,579 (GRCm39) D164V probably damaging Het
Vmn2r91 T A 17: 18,356,751 (GRCm39) M806K possibly damaging Het
Wdfy4 T A 14: 32,750,970 (GRCm39) Y2256F probably damaging Het
Wsb1 A G 11: 79,141,826 (GRCm39) S64P probably damaging Het
Zc3h11a C A 1: 133,552,350 (GRCm39) V586F probably benign Het
Zc3h12d A G 10: 7,729,014 (GRCm39) D126G probably damaging Het
Zfp296 G T 7: 19,313,637 (GRCm39) C164F possibly damaging Het
Zfp442 T A 2: 150,251,635 (GRCm39) H89L possibly damaging Het
Zfp82 T A 7: 29,756,312 (GRCm39) probably null Het
Zmynd8 A G 2: 165,676,871 (GRCm39) V249A possibly damaging Het
Other mutations in Dph5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Dph5 APN 3 115,693,362 (GRCm39) missense probably damaging 1.00
IGL02441:Dph5 APN 3 115,720,390 (GRCm39) missense possibly damaging 0.88
IGL02852:Dph5 APN 3 115,722,320 (GRCm39) missense possibly damaging 0.95
R0200:Dph5 UTSW 3 115,722,352 (GRCm39) missense probably benign 0.03
R0463:Dph5 UTSW 3 115,722,352 (GRCm39) missense probably benign 0.03
R0466:Dph5 UTSW 3 115,722,359 (GRCm39) missense probably benign 0.02
R0707:Dph5 UTSW 3 115,708,782 (GRCm39) missense probably benign 0.00
R4542:Dph5 UTSW 3 115,722,274 (GRCm39) missense probably damaging 1.00
R4601:Dph5 UTSW 3 115,693,426 (GRCm39) missense possibly damaging 0.93
R4950:Dph5 UTSW 3 115,722,292 (GRCm39) missense probably benign 0.33
R6504:Dph5 UTSW 3 115,720,452 (GRCm39) splice site probably null
R6662:Dph5 UTSW 3 115,722,205 (GRCm39) missense probably benign 0.00
R7431:Dph5 UTSW 3 115,686,381 (GRCm39) missense possibly damaging 0.67
R7565:Dph5 UTSW 3 115,686,446 (GRCm39) missense probably benign
R7822:Dph5 UTSW 3 115,693,399 (GRCm39) nonsense probably null
R9485:Dph5 UTSW 3 115,681,977 (GRCm39) intron probably benign
R9539:Dph5 UTSW 3 115,722,305 (GRCm39) missense probably damaging 1.00
R9646:Dph5 UTSW 3 115,708,692 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGAATTCATGAGTTGGATGGAA -3'
(R):5'- CAGCAAGATATATCAGGGAAGGCAT -3'

Sequencing Primer
(F):5'- GGATGGAAGATTAATGCCATTCAC -3'
(R):5'- CCAGCATATTGATGAAGAGT -3'
Posted On 2016-04-15