Mutagenetix > Incidental Mutation

Incidental Mutation 'R4932:Tecpr1'

380628

Institutional Source

Beutler Lab

Gene Symbol

Tecpr1

Ensembl Gene

ENSMUSG00000066621

Gene Name

tectonin beta-propeller repeat containing 1

Synonyms

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4932 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

144194442-144223615 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 144204658 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 798 (Y798N)

Ref Sequence

ENSEMBL: ENSMUSP00000082844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085701]

AlphaFold

Q80VP0

Predicted Effect

probably damaging
Transcript: ENSMUST00000085701
AA Change: Y798N

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: Y798N

Domain	Start	End	E-Value	Type
TECPR	23	59	8.98e1	SMART
DysFN	64	125	6.72e-24	SMART
DysFC	137	170	1.89e-9	SMART
TECPR	192	225	1.79e-1	SMART
TECPR	234	270	2.5e-9	SMART
TECPR	279	317	4.99e-9	SMART
TECPR	326	361	2.42e-7	SMART
low complexity region	381	394	N/A	INTRINSIC
PH	614	724	1.69e-2	SMART
TECPR	711	750	1.88e-4	SMART
TECPR	766	800	3.27e-4	SMART
DysFN	821	882	2.95e-20	SMART
DysFC	893	926	1.66e-14	SMART
TECPR	940	974	1.69e1	SMART
TECPR	983	1019	1.45e-5	SMART
TECPR	1028	1065	1.51e-8	SMART
TECPR	1074	1109	1.59e-2	SMART
low complexity region	1125	1137	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130962

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137149

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147992

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151479

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153103

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153751

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933417A18Rik	A	T	13: 34,932,630	T121S	possibly damaging	Het
Abcf1	A	T	17: 35,959,450	V616E	possibly damaging	Het
Adam21	A	G	12: 81,558,918	V690A	probably benign	Het
Afg3l1	A	T	8: 123,501,380	T635S	probably damaging	Het
Ahcyl2	T	A	6: 29,890,701	M390K	probably benign	Het
Ank3	T	A	10: 69,898,223		probably null	Het
Arhgef3	A	T	14: 27,384,213	K151N	probably damaging	Het
Ccr3	T	G	9: 124,029,006	F126C	probably damaging	Het
Ccser1	A	G	6: 61,718,191	D170G	possibly damaging	Het
Celsr2	T	A	3: 108,402,758	D1552V	probably damaging	Het
Cfap69	G	A	5: 5,625,820	L265F	probably damaging	Het
Chrna9	C	T	5: 65,969,190	R92*	probably null	Het
Cog3	A	T	14: 75,732,954	V341D	probably damaging	Het
Csmd1	C	A	8: 16,023,765	R2072L	probably damaging	Het
Dbf4	G	T	5: 8,398,039	H390Q	probably benign	Het
Dcaf4	T	A	12: 83,532,304	C166S	possibly damaging	Het
Dclk3	T	A	9: 111,468,042	L218Q	possibly damaging	Het
Dip2b	T	A	15: 100,171,722	W643R	probably damaging	Het
Dip2c	A	G	13: 9,623,972	K1091E	probably damaging	Het
Dis3	T	A	14: 99,088,904	H415L	probably damaging	Het
Dnah7a	T	A	1: 53,503,578	I2478F	possibly damaging	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Doc2a	T	C	7: 126,848,580		probably benign	Het
Dph5	A	T	3: 115,899,807	M125L	probably benign	Het
Dst	A	T	1: 34,228,683	T5247S	possibly damaging	Het
Eno4	T	G	19: 58,964,457	V477G	possibly damaging	Het
Exosc8	T	C	3: 54,729,290	I207V	possibly damaging	Het
Fam173a	T	G	17: 25,791,678		probably null	Het
Fat4	T	A	3: 39,007,203	S4312T	probably benign	Het
Fgfr2	T	C	7: 130,241,277	D126G	probably damaging	Het
Fgfr4	A	G	13: 55,168,170	T799A	unknown	Het
Gcn1l1	A	T	5: 115,592,144	D839V	probably benign	Het
Gprin3	A	G	6: 59,354,173	V383A	probably benign	Het
Gpt	T	C	15: 76,698,840	V361A	probably benign	Het
Hepacam	G	A	9: 37,381,764	C217Y	probably damaging	Het
Hsp90aa1	A	T	12: 110,693,717	Y382N	probably damaging	Het
Htr2a	T	A	14: 74,642,022	N30K	probably benign	Het
Jhy	A	T	9: 40,961,003	M70K	possibly damaging	Het
Lrrc19	T	C	4: 94,640,937	Y36C	probably damaging	Het
Madcam1	C	T	10: 79,665,613	Q171*	probably null	Het
Mcm8	G	A	2: 132,838,709	M544I	probably benign	Het
Mdga1	C	T	17: 29,857,606	G64E	probably damaging	Het
Mettl7a1	T	A	15: 100,305,106	F87Y	probably benign	Het
Mmp3	A	G	9: 7,446,994	D58G	probably benign	Het
Ms4a10	T	C	19: 10,964,768	Y123C	probably damaging	Het
Ms4a4d	T	A	19: 11,557,932	I198K	probably benign	Het
Mthfd1l	A	T	10: 3,980,241	D112V	probably benign	Het
N4bp2l2	A	C	5: 150,643,141	S567R	probably benign	Het
Ndufaf2	A	G	13: 108,158,476	Y32H	probably damaging	Het
Nup153	T	A	13: 46,712,737	K182*	probably null	Het
Olfr1186	A	G	2: 88,525,735	T51A	probably benign	Het
Olfr481	T	A	7: 108,081,574	V260E	probably damaging	Het
Olfr551	A	G	7: 102,588,416	F109S	probably damaging	Het
Otoa	T	C	7: 121,155,135	S928P	probably damaging	Het
Oxct2a	T	C	4: 123,322,703	D295G	probably benign	Het
P4ha2	C	A	11: 54,125,020	T411K	probably benign	Het
Plcg2	A	T	8: 117,607,083	Q865L	probably benign	Het
Prepl	G	T	17: 85,078,504	T244K	possibly damaging	Het
Ptpro	A	T	6: 137,411,105	K776*	probably null	Het
Rc3h2	T	C	2: 37,389,832	K462E	possibly damaging	Het
Scn10a	A	G	9: 119,687,874		probably null	Het
Serpinb1c	A	G	13: 32,882,164	V266A	probably damaging	Het
Slc6a20b	T	A	9: 123,604,796	N326Y	probably damaging	Het
Spcs2	C	T	7: 99,858,831	G16D	possibly damaging	Het
Spns3	T	C	11: 72,499,495	D441G	possibly damaging	Het
Srsf4	A	G	4: 131,891,245	D49G	probably damaging	Het
Tec	A	T	5: 72,760,393	C494*	probably null	Het
Trim56	C	T	5: 137,114,489	E58K	probably damaging	Het
Ttn	A	T	2: 76,796,134	D13146E	probably damaging	Het
Ube2q1	A	T	3: 89,779,483	K46*	probably null	Het
Ucn	G	T	5: 31,138,498	T8K	probably benign	Het
Usp25	T	C	16: 77,033,982		probably null	Het
Usp48	A	T	4: 137,615,833	Q430L	probably benign	Het
Usp48	A	T	4: 137,615,834		probably null	Het
Vill	A	T	9: 119,061,511	D164V	probably damaging	Het
Vmn2r91	T	A	17: 18,136,489	M806K	possibly damaging	Het
Wdfy4	T	A	14: 33,029,013	Y2256F	probably damaging	Het
Wsb1	A	G	11: 79,251,000	S64P	probably damaging	Het
Zc3h11a	C	A	1: 133,624,612	V586F	probably benign	Het
Zc3h12d	A	G	10: 7,853,250	D126G	probably damaging	Het
Zfp296	G	T	7: 19,579,712	C164F	possibly damaging	Het
Zfp442	T	A	2: 150,409,715	H89L	possibly damaging	Het
Zfp82	T	A	7: 30,056,887		probably null	Het
Zmynd8	A	G	2: 165,834,951	V249A	possibly damaging	Het

Other mutations in Tecpr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01399:Tecpr1	APN	5	144208593	critical splice donor site	probably null
IGL01774:Tecpr1	APN	5	144211540	missense	probably damaging	0.97
IGL01960:Tecpr1	APN	5	144216919	missense	probably benign	0.00
IGL01973:Tecpr1	APN	5	144197988	splice site	probably benign
IGL02244:Tecpr1	APN	5	144210003	missense	probably benign
IGL02247:Tecpr1	APN	5	144206554	missense	possibly damaging	0.64
IGL02423:Tecpr1	APN	5	144203487	missense	possibly damaging	0.88
IGL02679:Tecpr1	APN	5	144206546	missense	probably benign	0.28
larghissimo	UTSW	5	144217257	missense	probably damaging	1.00
PIT4531001:Tecpr1	UTSW	5	144214067	missense	probably damaging	0.96
R0121:Tecpr1	UTSW	5	144210199	missense	probably benign	0.02
R0125:Tecpr1	UTSW	5	144197899	missense	probably damaging	1.00
R0194:Tecpr1	UTSW	5	144218517	missense	probably damaging	1.00
R0376:Tecpr1	UTSW	5	144207476	missense	possibly damaging	0.94
R0441:Tecpr1	UTSW	5	144195941	missense	probably benign
R0504:Tecpr1	UTSW	5	144214081	missense	probably damaging	0.99
R0538:Tecpr1	UTSW	5	144206274	missense	probably damaging	0.99
R0586:Tecpr1	UTSW	5	144217401	missense	probably damaging	1.00
R0607:Tecpr1	UTSW	5	144212590	missense	probably damaging	1.00
R0608:Tecpr1	UTSW	5	144211499	missense	probably damaging	1.00
R0656:Tecpr1	UTSW	5	144214053	splice site	probably null
R0835:Tecpr1	UTSW	5	144212592	missense	possibly damaging	0.81
R1080:Tecpr1	UTSW	5	144216929	missense	probably damaging	1.00
R1394:Tecpr1	UTSW	5	144206539	missense	possibly damaging	0.77
R1597:Tecpr1	UTSW	5	144214310	missense	probably benign	0.00
R1663:Tecpr1	UTSW	5	144197944	missense	probably benign	0.17
R1785:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R1786:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R1833:Tecpr1	UTSW	5	144208608	missense	probably damaging	0.99
R1883:Tecpr1	UTSW	5	144206529	missense	probably benign	0.03
R1988:Tecpr1	UTSW	5	144204697	missense	possibly damaging	0.94
R2130:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2131:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2132:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2133:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2172:Tecpr1	UTSW	5	144196417	missense	probably damaging	1.00
R2172:Tecpr1	UTSW	5	144211456	missense	probably benign	0.10
R2290:Tecpr1	UTSW	5	144214063	missense	probably damaging	0.99
R3691:Tecpr1	UTSW	5	144209979	missense	probably benign	0.10
R4027:Tecpr1	UTSW	5	144206259	missense	probably benign	0.41
R4587:Tecpr1	UTSW	5	144212590	missense	probably damaging	0.96
R4684:Tecpr1	UTSW	5	144207437	missense	probably benign	0.16
R4864:Tecpr1	UTSW	5	144214117	missense	probably benign	0.00
R4955:Tecpr1	UTSW	5	144217257	missense	probably damaging	1.00
R5043:Tecpr1	UTSW	5	144197854	splice site	probably null
R5459:Tecpr1	UTSW	5	144207416	missense	probably damaging	1.00
R5579:Tecpr1	UTSW	5	144214344	missense	possibly damaging	0.55
R5677:Tecpr1	UTSW	5	144218633	nonsense	probably null
R5679:Tecpr1	UTSW	5	144207423	missense	possibly damaging	0.69
R5802:Tecpr1	UTSW	5	144206546	missense	probably benign	0.28
R6000:Tecpr1	UTSW	5	144211421	missense	probably benign	0.02
R6022:Tecpr1	UTSW	5	144199191	missense	possibly damaging	0.95
R6114:Tecpr1	UTSW	5	144204640	missense	possibly damaging	0.81
R6251:Tecpr1	UTSW	5	144198576	missense	probably damaging	0.97
R6372:Tecpr1	UTSW	5	144216958	missense	probably damaging	1.00
R6493:Tecpr1	UTSW	5	144209974	missense	probably benign
R7276:Tecpr1	UTSW	5	144217020	nonsense	probably null
R7314:Tecpr1	UTSW	5	144217332	missense	probably damaging	1.00
R7375:Tecpr1	UTSW	5	144208599	missense	possibly damaging	0.68
R7632:Tecpr1	UTSW	5	144218726	missense	probably benign	0.03
R7702:Tecpr1	UTSW	5	144203418	missense	probably damaging	1.00
R8135:Tecpr1	UTSW	5	144198602	missense	probably damaging	0.99
R8406:Tecpr1	UTSW	5	144200840	missense	probably damaging	1.00
R8844:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8856:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8857:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8866:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8903:Tecpr1	UTSW	5	144214027	intron	probably benign
R8926:Tecpr1	UTSW	5	144216962	missense	probably damaging	1.00
R9218:Tecpr1	UTSW	5	144217231	missense	possibly damaging	0.70
R9423:Tecpr1	UTSW	5	144218578	missense	probably damaging	0.98
RF001:Tecpr1	UTSW	5	144217386	missense	probably damaging	0.99
Z1176:Tecpr1	UTSW	5	144218591	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- TCTTGAGCCCCGTGAATTG -3'
(R):5'- CACGTGAGGTCTAACTCCAG -3'

Sequencing Primer
(F):5'- TGAATTGGCCTGAGACTGCC -3'
(R):5'- TCTAACTCCAGGGTGGGTGAC -3'

Posted On

2016-04-15