Mutagenetix > Incidental Mutation

Incidental Mutation 'R4932:Vill'

380651

Institutional Source

Beutler Lab

Gene Symbol

Vill

Ensembl Gene

ENSMUSG00000038775

Gene Name

villin-like

Synonyms

Villp

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R4932 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119052778-119071525 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 119061511 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 164 (D164V)

Ref Sequence

ENSEMBL: ENSMUSP00000074294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051386] [ENSMUST00000074734] [ENSMUST00000126251] [ENSMUST00000131647] [ENSMUST00000136561] [ENSMUST00000141185]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000051386
AA Change: D164V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000061731
Gene: ENSMUSG00000038775
AA Change: D164V

Domain	Start	End	E-Value	Type
GEL	14	114	4.59e-13	SMART
GEL	135	227	4.18e-16	SMART
GEL	252	348	8.35e-25	SMART
GEL	391	488	7.92e-17	SMART
GEL	508	594	4.38e-19	SMART
GEL	613	706	7.8e-16	SMART
VHP	824	859	2.12e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000074734
AA Change: D164V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074294
Gene: ENSMUSG00000038775
AA Change: D164V

Domain	Start	End	E-Value	Type
GEL	14	114	4.59e-13	SMART
GEL	135	227	4.18e-16	SMART
GEL	252	348	8.35e-25	SMART
GEL	391	488	7.92e-17	SMART
GEL	508	594	4.38e-19	SMART
VHP	740	775	2.12e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000126251

SMART Domains

Protein: ENSMUSP00000116262
Gene: ENSMUSG00000038775

Domain	Start	End	E-Value	Type
Blast:GEL	1	56	9e-21	BLAST
GEL	63	149	4.38e-19	SMART
GEL	168	261	7.8e-16	SMART
VHP	357	392	2.12e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131647

SMART Domains

Protein: ENSMUSP00000118375
Gene: ENSMUSG00000038775

Domain	Start	End	E-Value	Type
SCOP:d1d4xg_	7	85	6e-23	SMART
Blast:GEL	14	85	1e-48	BLAST
PDB:2VIL\|A	15	82	1e-15	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135872

Predicted Effect

probably benign
Transcript: ENSMUST00000136561

SMART Domains

Protein: ENSMUSP00000123393
Gene: ENSMUSG00000038775

Domain	Start	End	E-Value	Type
GEL	1	96	2.46e-13	SMART
Blast:GEL	116	140	2e-8	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000141185

SMART Domains

Protein: ENSMUSP00000116546
Gene: ENSMUSG00000038775

Domain	Start	End	E-Value	Type
GEL	7	104	7.92e-17	SMART
GEL	124	210	4.38e-19	SMART
GEL	229	322	7.8e-16	SMART
VHP	440	475	2.12e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151638

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153454

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153630

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the villin/gelsolin family. It contains 6 gelsolin-like repeats and a headpiece domain. It may play a role in actin-bundling. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933417A18Rik	A	T	13: 34,932,630	T121S	possibly damaging	Het
Abcf1	A	T	17: 35,959,450	V616E	possibly damaging	Het
Adam21	A	G	12: 81,558,918	V690A	probably benign	Het
Afg3l1	A	T	8: 123,501,380	T635S	probably damaging	Het
Ahcyl2	T	A	6: 29,890,701	M390K	probably benign	Het
Ank3	T	A	10: 69,898,223		probably null	Het
Arhgef3	A	T	14: 27,384,213	K151N	probably damaging	Het
Ccr3	T	G	9: 124,029,006	F126C	probably damaging	Het
Ccser1	A	G	6: 61,718,191	D170G	possibly damaging	Het
Celsr2	T	A	3: 108,402,758	D1552V	probably damaging	Het
Cfap69	G	A	5: 5,625,820	L265F	probably damaging	Het
Chrna9	C	T	5: 65,969,190	R92*	probably null	Het
Cog3	A	T	14: 75,732,954	V341D	probably damaging	Het
Csmd1	C	A	8: 16,023,765	R2072L	probably damaging	Het
Dbf4	G	T	5: 8,398,039	H390Q	probably benign	Het
Dcaf4	T	A	12: 83,532,304	C166S	possibly damaging	Het
Dclk3	T	A	9: 111,468,042	L218Q	possibly damaging	Het
Dip2b	T	A	15: 100,171,722	W643R	probably damaging	Het
Dip2c	A	G	13: 9,623,972	K1091E	probably damaging	Het
Dis3	T	A	14: 99,088,904	H415L	probably damaging	Het
Dnah7a	T	A	1: 53,503,578	I2478F	possibly damaging	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Doc2a	T	C	7: 126,848,580		probably benign	Het
Dph5	A	T	3: 115,899,807	M125L	probably benign	Het
Dst	A	T	1: 34,228,683	T5247S	possibly damaging	Het
Eno4	T	G	19: 58,964,457	V477G	possibly damaging	Het
Exosc8	T	C	3: 54,729,290	I207V	possibly damaging	Het
Fam173a	T	G	17: 25,791,678		probably null	Het
Fat4	T	A	3: 39,007,203	S4312T	probably benign	Het
Fgfr2	T	C	7: 130,241,277	D126G	probably damaging	Het
Fgfr4	A	G	13: 55,168,170	T799A	unknown	Het
Gcn1l1	A	T	5: 115,592,144	D839V	probably benign	Het
Gprin3	A	G	6: 59,354,173	V383A	probably benign	Het
Gpt	T	C	15: 76,698,840	V361A	probably benign	Het
Hepacam	G	A	9: 37,381,764	C217Y	probably damaging	Het
Hsp90aa1	A	T	12: 110,693,717	Y382N	probably damaging	Het
Htr2a	T	A	14: 74,642,022	N30K	probably benign	Het
Jhy	A	T	9: 40,961,003	M70K	possibly damaging	Het
Lrrc19	T	C	4: 94,640,937	Y36C	probably damaging	Het
Madcam1	C	T	10: 79,665,613	Q171*	probably null	Het
Mcm8	G	A	2: 132,838,709	M544I	probably benign	Het
Mdga1	C	T	17: 29,857,606	G64E	probably damaging	Het
Mettl7a1	T	A	15: 100,305,106	F87Y	probably benign	Het
Mmp3	A	G	9: 7,446,994	D58G	probably benign	Het
Ms4a10	T	C	19: 10,964,768	Y123C	probably damaging	Het
Ms4a4d	T	A	19: 11,557,932	I198K	probably benign	Het
Mthfd1l	A	T	10: 3,980,241	D112V	probably benign	Het
N4bp2l2	A	C	5: 150,643,141	S567R	probably benign	Het
Ndufaf2	A	G	13: 108,158,476	Y32H	probably damaging	Het
Nup153	T	A	13: 46,712,737	K182*	probably null	Het
Olfr1186	A	G	2: 88,525,735	T51A	probably benign	Het
Olfr481	T	A	7: 108,081,574	V260E	probably damaging	Het
Olfr551	A	G	7: 102,588,416	F109S	probably damaging	Het
Otoa	T	C	7: 121,155,135	S928P	probably damaging	Het
Oxct2a	T	C	4: 123,322,703	D295G	probably benign	Het
P4ha2	C	A	11: 54,125,020	T411K	probably benign	Het
Plcg2	A	T	8: 117,607,083	Q865L	probably benign	Het
Prepl	G	T	17: 85,078,504	T244K	possibly damaging	Het
Ptpro	A	T	6: 137,411,105	K776*	probably null	Het
Rc3h2	T	C	2: 37,389,832	K462E	possibly damaging	Het
Scn10a	A	G	9: 119,687,874		probably null	Het
Serpinb1c	A	G	13: 32,882,164	V266A	probably damaging	Het
Slc6a20b	T	A	9: 123,604,796	N326Y	probably damaging	Het
Spcs2	C	T	7: 99,858,831	G16D	possibly damaging	Het
Spns3	T	C	11: 72,499,495	D441G	possibly damaging	Het
Srsf4	A	G	4: 131,891,245	D49G	probably damaging	Het
Tec	A	T	5: 72,760,393	C494*	probably null	Het
Tecpr1	A	T	5: 144,204,658	Y798N	probably damaging	Het
Trim56	C	T	5: 137,114,489	E58K	probably damaging	Het
Ttn	A	T	2: 76,796,134	D13146E	probably damaging	Het
Ube2q1	A	T	3: 89,779,483	K46*	probably null	Het
Ucn	G	T	5: 31,138,498	T8K	probably benign	Het
Usp25	T	C	16: 77,033,982		probably null	Het
Usp48	A	T	4: 137,615,833	Q430L	probably benign	Het
Usp48	A	T	4: 137,615,834		probably null	Het
Vmn2r91	T	A	17: 18,136,489	M806K	possibly damaging	Het
Wdfy4	T	A	14: 33,029,013	Y2256F	probably damaging	Het
Wsb1	A	G	11: 79,251,000	S64P	probably damaging	Het
Zc3h11a	C	A	1: 133,624,612	V586F	probably benign	Het
Zc3h12d	A	G	10: 7,853,250	D126G	probably damaging	Het
Zfp296	G	T	7: 19,579,712	C164F	possibly damaging	Het
Zfp442	T	A	2: 150,409,715	H89L	possibly damaging	Het
Zfp82	T	A	7: 30,056,887		probably null	Het
Zmynd8	A	G	2: 165,834,951	V249A	possibly damaging	Het

Other mutations in Vill

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Vill	APN	9	119063312	missense	probably damaging	1.00
IGL01024:Vill	APN	9	119070350	critical splice donor site	probably null
IGL01934:Vill	APN	9	119066809	missense	probably damaging	1.00
IGL02118:Vill	APN	9	119060398	missense	probably benign	0.44
IGL02260:Vill	APN	9	119058441	missense	probably benign	0.00
IGL02507:Vill	APN	9	119070777	missense	possibly damaging	0.86
IGL02870:Vill	APN	9	119061899	missense	probably damaging	1.00
IGL02941:Vill	APN	9	119066887	unclassified	probably benign
IGL02835:Vill	UTSW	9	119067445	missense	probably benign	0.11
R0285:Vill	UTSW	9	119070827	unclassified	probably benign
R0571:Vill	UTSW	9	119070633	missense	possibly damaging	0.93
R1024:Vill	UTSW	9	119066824	missense	probably damaging	1.00
R1168:Vill	UTSW	9	119070321	missense	probably damaging	0.99
R1374:Vill	UTSW	9	119061494	missense	probably benign	0.03
R1400:Vill	UTSW	9	119063347	missense	probably benign	0.01
R1551:Vill	UTSW	9	119063372	missense	probably benign
R1584:Vill	UTSW	9	119065586	missense	probably damaging	1.00
R1630:Vill	UTSW	9	119070701	missense	probably benign	0.37
R1721:Vill	UTSW	9	119066014	missense	probably damaging	0.98
R1946:Vill	UTSW	9	119058492	missense	probably benign
R2311:Vill	UTSW	9	119065897	missense	probably benign	0.08
R2392:Vill	UTSW	9	119067560	unclassified	probably benign
R2509:Vill	UTSW	9	119070302	missense	possibly damaging	0.84
R2760:Vill	UTSW	9	119066882	critical splice donor site	probably null
R3886:Vill	UTSW	9	119066714	missense	probably benign	0.24
R3944:Vill	UTSW	9	119068431	missense	probably benign	0.10
R4245:Vill	UTSW	9	119071291	unclassified	probably benign
R4246:Vill	UTSW	9	119060393	missense	probably damaging	1.00
R4771:Vill	UTSW	9	119068434	missense	probably damaging	1.00
R4889:Vill	UTSW	9	119063341	missense	possibly damaging	0.50
R4946:Vill	UTSW	9	119068440	missense	probably damaging	1.00
R5121:Vill	UTSW	9	119070025	missense	possibly damaging	0.92
R5646:Vill	UTSW	9	119071162	missense	probably damaging	1.00
R6089:Vill	UTSW	9	119057799	missense	probably benign	0.00
R6149:Vill	UTSW	9	119058414	missense	possibly damaging	0.67
R6167:Vill	UTSW	9	119066864	missense	probably damaging	0.98
R6318:Vill	UTSW	9	119063648	missense	probably benign	0.15
R6319:Vill	UTSW	9	119063648	missense	probably benign	0.15
R6590:Vill	UTSW	9	119061907	missense	probably benign	0.04
R6690:Vill	UTSW	9	119061907	missense	probably benign	0.04
R6889:Vill	UTSW	9	119065882	missense	possibly damaging	0.58
R7207:Vill	UTSW	9	119071213	missense	possibly damaging	0.64
R7353:Vill	UTSW	9	119065493	missense	probably damaging	0.99
R7398:Vill	UTSW	9	119070648	missense	probably benign	0.26
R7883:Vill	UTSW	9	119065521	nonsense	probably null
R8165:Vill	UTSW	9	119066753	missense	probably damaging	0.98
R8281:Vill	UTSW	9	119058479	missense	probably damaging	1.00
R8380:Vill	UTSW	9	119057849	missense	probably benign	0.04
R8685:Vill	UTSW	9	119066727	missense	probably benign	0.00
R8847:Vill	UTSW	9	119068446	missense	probably damaging	0.99
R8968:Vill	UTSW	9	119063603	critical splice donor site	probably null
R9290:Vill	UTSW	9	119061494	missense	probably benign	0.03
RF005:Vill	UTSW	9	119060439	missense	probably damaging	1.00
Z1176:Vill	UTSW	9	119069965	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGACATGCCCTGCCTTG -3'
(R):5'- CCTGTATCTAGTAGACGCCCTTTG -3'

Sequencing Primer
(F):5'- ACATGCCCTGCCTTGCTCTC -3'
(R):5'- GCCCTTTGGGTGGAAACAG -3'

Posted On

2016-04-15