Mutagenetix > Incidental Mutation

Incidental Mutation 'R4933:Kif21b'

380694

Institutional Source

Beutler Lab

Gene Symbol

Kif21b

Ensembl Gene

ENSMUSG00000041642

Gene Name

kinesin family member 21B

Synonyms

N-5 kinesin, 2610511N21Rik

MMRRC Submission

042533-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R4933 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

136131389-136177998 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 136151325 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000074661 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075164] [ENSMUST00000075164] [ENSMUST00000130864]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000075164

SMART Domains

Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	3.81e-5	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000075164

SMART Domains

Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	3.81e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122892

Predicted Effect

probably benign
Transcript: ENSMUST00000130864

SMART Domains

Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	5.1e-6	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.4%
20x: 89.3%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous KO reduces dendrite branching and spine density as a result of reduced microtubule growth, resulting in impaired spatial learning and cued conditioning behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	A	G	7: 41,626,802	E643G	probably damaging	Het
4430402I18Rik	G	T	19: 28,941,775	H195N	possibly damaging	Het
Abca2	T	C	2: 25,444,827	V1937A	probably benign	Het
Acot10	A	T	15: 20,666,330	N108K	possibly damaging	Het
Agtpbp1	A	T	13: 59,500,572	M478K	probably benign	Het
Akirin1	G	A	4: 123,736,858	S191F	probably damaging	Het
Aurkb	T	C	11: 69,048,144		probably benign	Het
Cabyr	T	C	18: 12,744,492		probably benign	Het
Ccp110	A	G	7: 118,725,319	E688G	probably damaging	Het
Champ1	T	A	8: 13,879,137	S432T	probably benign	Het
Crybg1	T	A	10: 43,999,213	N633I	probably damaging	Het
Dagla	A	T	19: 10,269,715		probably null	Het
Dkkl1	A	T	7: 45,211,525	L10Q	probably null	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
E430018J23Rik	A	G	7: 127,393,349	Y30H	probably damaging	Het
Fndc7	G	T	3: 108,876,670	Q208K	probably benign	Het
Gins4	A	T	8: 23,234,780	C53S	probably damaging	Het
Gja8	T	A	3: 96,919,035		probably benign	Het
Golph3l	T	A	3: 95,617,423	N328K	probably benign	Het
Haus6	A	C	4: 86,585,287		probably benign	Het
Hdac5	A	G	11: 102,200,563		probably benign	Het
Ide	A	G	19: 37,277,756	Y883H	unknown	Het
Igf2r	A	G	17: 12,691,877		probably null	Het
Kdm3b	T	C	18: 34,810,393	Y723H	probably damaging	Het
Lancl1	A	T	1: 67,021,034	N77K	probably benign	Het
Lyst	G	A	13: 13,759,378	V3554I	probably benign	Het
Lyst	T	A	13: 13,637,764	N920K	probably damaging	Het
Map1a	G	A	2: 121,305,905	A2163T	probably damaging	Het
Mapk7	G	T	11: 61,493,908		probably benign	Het
Myo10	C	A	15: 25,781,118	Q154K	probably damaging	Het
Olfr13	C	T	6: 43,174,321	L112F	probably benign	Het
Olfr132	A	G	17: 38,130,550	I214T	probably damaging	Het
Pcdhgb2	G	A	18: 37,692,214	V753M	probably benign	Het
Pnn	T	A	12: 59,070,227	L195Q	probably damaging	Het
Pot1a	A	G	6: 25,771,541	V227A	possibly damaging	Het
Ppp1r21	T	A	17: 88,547,621	D109E	probably benign	Het
Prr15l	G	A	11: 96,934,762	G73S	probably damaging	Het
Rnf148	A	G	6: 23,654,340	F219S	probably benign	Het
Rnpep	C	A	1: 135,267,026		probably benign	Het
Ryr1	T	C	7: 29,104,298	T643A	probably damaging	Het
Ryr2	A	T	13: 11,945,945	C36S	probably damaging	Het
Shc3	G	T	13: 51,442,769	T406N	probably benign	Het
Slit3	G	T	11: 35,688,593	G1199V	probably damaging	Het
Sptbn5	G	A	2: 120,050,120		noncoding transcript	Het
St8sia6	T	C	2: 13,665,442	N236D	probably damaging	Het
Stpg1	A	T	4: 135,506,416	Q3L	probably benign	Het
Sult3a1	T	A	10: 33,866,554	I59N	probably damaging	Het
Svs1	T	C	6: 48,987,492	S145P	probably damaging	Het
Vmn1r208	T	G	13: 22,772,788	I180L	probably benign	Het
Vmn2r51	A	T	7: 10,098,320	N446K	probably damaging	Het
Vmn2r63	A	T	7: 42,903,978	I618N	probably damaging	Het
Wrn	T	C	8: 33,322,343	N182S	probably benign	Het
Zfp296	G	T	7: 19,579,712	C164F	possibly damaging	Het
Zmynd8	A	G	2: 165,834,951	V249A	possibly damaging	Het
Zswim2	A	G	2: 83,925,227	L110P	probably damaging	Het

Other mutations in Kif21b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Kif21b	APN	1	136152342	missense	possibly damaging	0.68
IGL01020:Kif21b	APN	1	136154094	splice site	probably benign
IGL01288:Kif21b	APN	1	136172184	missense	probably benign	0.00
IGL02105:Kif21b	APN	1	136171303	missense	probably benign
IGL02264:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02303:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02308:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02310:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02419:Kif21b	APN	1	136151267	missense	probably benign	0.00
IGL02553:Kif21b	APN	1	136154121	missense	probably damaging	1.00
IGL02568:Kif21b	APN	1	136172867	missense	probably damaging	0.96
IGL02657:Kif21b	APN	1	136172230	missense	possibly damaging	0.88
IGL03068:Kif21b	APN	1	136158355	unclassified	probably benign
IGL03230:Kif21b	APN	1	136162812	missense	probably benign	0.03
R0629_Kif21b_729	UTSW	1	136172157	critical splice acceptor site	probably null
Schiessen	UTSW	1	136147869	critical splice donor site	probably null
wolfen	UTSW	1	136144758	nonsense	probably null
R0190:Kif21b	UTSW	1	136171219	missense	probably benign	0.32
R0349:Kif21b	UTSW	1	136149311	missense	probably damaging	0.97
R0501:Kif21b	UTSW	1	136163099	missense	probably benign	0.44
R0620:Kif21b	UTSW	1	136159428	missense	possibly damaging	0.88
R0629:Kif21b	UTSW	1	136172157	critical splice acceptor site	probably null
R0741:Kif21b	UTSW	1	136159744	missense	probably damaging	1.00
R1087:Kif21b	UTSW	1	136162823	missense	probably damaging	1.00
R1217:Kif21b	UTSW	1	136152376	missense	probably damaging	1.00
R1464:Kif21b	UTSW	1	136156153	missense	possibly damaging	0.50
R1464:Kif21b	UTSW	1	136156153	missense	possibly damaging	0.50
R1511:Kif21b	UTSW	1	136169324	critical splice donor site	probably null
R1512:Kif21b	UTSW	1	136152805	missense	probably benign	0.01
R1513:Kif21b	UTSW	1	136156111	missense	probably damaging	0.98
R1591:Kif21b	UTSW	1	136149317	missense	probably damaging	1.00
R1616:Kif21b	UTSW	1	136171685	missense	probably damaging	1.00
R1628:Kif21b	UTSW	1	136171220	missense	probably benign	0.01
R1658:Kif21b	UTSW	1	136171285	missense	probably damaging	1.00
R1728:Kif21b	UTSW	1	136160121	missense	possibly damaging	0.85
R1741:Kif21b	UTSW	1	136156142	missense	probably damaging	1.00
R1784:Kif21b	UTSW	1	136160121	missense	possibly damaging	0.85
R1807:Kif21b	UTSW	1	136147793	missense	possibly damaging	0.94
R1896:Kif21b	UTSW	1	136147845	missense	possibly damaging	0.90
R1970:Kif21b	UTSW	1	136171156	missense	probably damaging	1.00
R1984:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1985:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1986:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1988:Kif21b	UTSW	1	136152264	missense	probably damaging	0.98
R1990:Kif21b	UTSW	1	136161770	missense	probably damaging	1.00
R2014:Kif21b	UTSW	1	136148282	missense	probably damaging	1.00
R2045:Kif21b	UTSW	1	136160313	missense	probably damaging	1.00
R2141:Kif21b	UTSW	1	136152264	missense	probably damaging	0.98
R2248:Kif21b	UTSW	1	136172966	missense	probably damaging	1.00
R2886:Kif21b	UTSW	1	136147874	splice site	probably benign
R2896:Kif21b	UTSW	1	136154217	missense	possibly damaging	0.82
R3706:Kif21b	UTSW	1	136159410	missense	probably benign	0.06
R3780:Kif21b	UTSW	1	136156226	missense	probably damaging	0.99
R3827:Kif21b	UTSW	1	136162994	critical splice donor site	probably null
R4227:Kif21b	UTSW	1	136154093	splice site	probably null
R4600:Kif21b	UTSW	1	136147864	missense	probably benign	0.39
R4608:Kif21b	UTSW	1	136148186	intron	probably benign
R4749:Kif21b	UTSW	1	136144749	nonsense	probably null
R4841:Kif21b	UTSW	1	136145220	missense	probably damaging	1.00
R4842:Kif21b	UTSW	1	136145220	missense	probably damaging	1.00
R4959:Kif21b	UTSW	1	136148370	missense	possibly damaging	0.90
R5018:Kif21b	UTSW	1	136172234	missense	probably benign	0.30
R5116:Kif21b	UTSW	1	136152783	missense	probably damaging	0.99
R5119:Kif21b	UTSW	1	136163100	missense	probably benign
R5197:Kif21b	UTSW	1	136144625	missense	probably damaging	1.00
R5230:Kif21b	UTSW	1	136171673	missense	probably damaging	1.00
R5249:Kif21b	UTSW	1	136169228	missense	probably damaging	1.00
R5337:Kif21b	UTSW	1	136171143	missense	probably damaging	1.00
R5358:Kif21b	UTSW	1	136172292	missense	possibly damaging	0.85
R5466:Kif21b	UTSW	1	136147525	missense	probably damaging	1.00
R5557:Kif21b	UTSW	1	136170059	missense	probably damaging	1.00
R5727:Kif21b	UTSW	1	136170009	missense	probably damaging	1.00
R5865:Kif21b	UTSW	1	136151137	nonsense	probably null
R5929:Kif21b	UTSW	1	136151207	missense	probably damaging	1.00
R6274:Kif21b	UTSW	1	136149418	missense	possibly damaging	0.57
R6349:Kif21b	UTSW	1	136158326	missense	probably damaging	1.00
R6648:Kif21b	UTSW	1	136152397	missense	probably benign	0.00
R6831:Kif21b	UTSW	1	136144758	nonsense	probably null
R7156:Kif21b	UTSW	1	136147824	missense	probably damaging	1.00
R7165:Kif21b	UTSW	1	136149448	missense	probably damaging	0.98
R7327:Kif21b	UTSW	1	136159649	missense	possibly damaging	0.60
R7680:Kif21b	UTSW	1	136147869	critical splice donor site	probably null
R7975:Kif21b	UTSW	1	136171173	missense	probably damaging	1.00
R8356:Kif21b	UTSW	1	136172945	missense	probably damaging	1.00
R8467:Kif21b	UTSW	1	136172283	missense	probably damaging	0.98
R9031:Kif21b	UTSW	1	136145304	missense	probably damaging	0.99
R9101:Kif21b	UTSW	1	136151155	missense	probably damaging	0.96
R9191:Kif21b	UTSW	1	136172821	nonsense	probably null
R9261:Kif21b	UTSW	1	136149424	missense	probably damaging	1.00
R9280:Kif21b	UTSW	1	136171707	critical splice donor site	probably null
R9307:Kif21b	UTSW	1	136174062	missense	probably benign
R9562:Kif21b	UTSW	1	136149352	missense	probably damaging	0.99
R9563:Kif21b	UTSW	1	136149428	missense	probably damaging	1.00
R9565:Kif21b	UTSW	1	136149352	missense	probably damaging	0.99
R9758:Kif21b	UTSW	1	136153223	missense	probably damaging	1.00
R9760:Kif21b	UTSW	1	136148683	missense	probably damaging	1.00
RF024:Kif21b	UTSW	1	136158341	missense	probably damaging	1.00
X0053:Kif21b	UTSW	1	136149316	missense	probably damaging	1.00
X0066:Kif21b	UTSW	1	136172945	missense	probably damaging	1.00
Z1176:Kif21b	UTSW	1	136154137	missense	probably benign	0.00
Z1177:Kif21b	UTSW	1	136148312	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGGGATTCAGCACCTGACTG -3'
(R):5'- ACTGTGTGCCTCTTACATGTTTAAG -3'

Sequencing Primer
(F):5'- TGTCTCCATCCCAGGGCAAG -3'
(R):5'- CTCTTACATGTTTAAGAGGAAGGCTG -3'

Posted On

2016-04-15