Incidental Mutation 'R4933:Map1a'
ID 380700
Institutional Source Beutler Lab
Gene Symbol Map1a
Ensembl Gene ENSMUSG00000027254
Gene Name microtubule-associated protein 1 A
Synonyms Mtap1, Mtap-1, 6330416M19Rik, Mtap1a
MMRRC Submission 042533-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.390) question?
Stock # R4933 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 121289600-121310832 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 121305905 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 2163 (A2163T)
Ref Sequence ENSEMBL: ENSMUSP00000106269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052029] [ENSMUST00000094639] [ENSMUST00000110625] [ENSMUST00000110626] [ENSMUST00000110627] [ENSMUST00000110628] [ENSMUST00000110639]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000052029
SMART Domains Protein: ENSMUSP00000057632
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.8e-110 PFAM
low complexity region 1163 1181 N/A INTRINSIC
coiled coil region 1402 1430 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094639
AA Change: A2401T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092223
Gene: ENSMUSG00000027254
AA Change: A2401T

DomainStartEndE-ValueType
Blast:Lactamase_B 286 538 2e-54 BLAST
SCOP:d1eq1a_ 584 699 8e-5 SMART
low complexity region 743 755 N/A INTRINSIC
low complexity region 820 833 N/A INTRINSIC
low complexity region 852 867 N/A INTRINSIC
low complexity region 897 911 N/A INTRINSIC
low complexity region 1228 1239 N/A INTRINSIC
low complexity region 1334 1344 N/A INTRINSIC
low complexity region 1540 1555 N/A INTRINSIC
coiled coil region 1573 1602 N/A INTRINSIC
internal_repeat_1 1616 1726 7.66e-6 PROSPERO
coiled coil region 1747 1771 N/A INTRINSIC
internal_repeat_1 1774 1888 7.66e-6 PROSPERO
low complexity region 2060 2084 N/A INTRINSIC
low complexity region 2121 2133 N/A INTRINSIC
low complexity region 2156 2169 N/A INTRINSIC
low complexity region 2383 2396 N/A INTRINSIC
low complexity region 2436 2460 N/A INTRINSIC
low complexity region 2517 2541 N/A INTRINSIC
low complexity region 2589 2600 N/A INTRINSIC
low complexity region 2662 2682 N/A INTRINSIC
low complexity region 2685 2704 N/A INTRINSIC
low complexity region 2716 2728 N/A INTRINSIC
low complexity region 2766 2790 N/A INTRINSIC
low complexity region 2980 2988 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110625
SMART Domains Protein: ENSMUSP00000106255
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110626
SMART Domains Protein: ENSMUSP00000106256
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 1.1e-135 PFAM
low complexity region 1163 1181 N/A INTRINSIC
coiled coil region 1402 1430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110627
SMART Domains Protein: ENSMUSP00000106257
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110628
SMART Domains Protein: ENSMUSP00000106258
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 886 3.9e-101 PFAM
low complexity region 1143 1161 N/A INTRINSIC
coiled coil region 1382 1410 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110639
AA Change: A2163T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106269
Gene: ENSMUSG00000027254
AA Change: A2163T

DomainStartEndE-ValueType
Blast:Lactamase_B 48 300 3e-54 BLAST
SCOP:d1eq1a_ 346 461 1e-4 SMART
low complexity region 505 517 N/A INTRINSIC
low complexity region 582 595 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
low complexity region 659 673 N/A INTRINSIC
low complexity region 990 1001 N/A INTRINSIC
low complexity region 1096 1106 N/A INTRINSIC
low complexity region 1302 1317 N/A INTRINSIC
coiled coil region 1335 1364 N/A INTRINSIC
internal_repeat_1 1378 1488 5.43e-6 PROSPERO
coiled coil region 1509 1533 N/A INTRINSIC
internal_repeat_1 1536 1650 5.43e-6 PROSPERO
low complexity region 1822 1846 N/A INTRINSIC
low complexity region 1883 1895 N/A INTRINSIC
low complexity region 1918 1931 N/A INTRINSIC
low complexity region 2145 2158 N/A INTRINSIC
low complexity region 2198 2222 N/A INTRINSIC
low complexity region 2279 2303 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
low complexity region 2424 2444 N/A INTRINSIC
low complexity region 2447 2466 N/A INTRINSIC
low complexity region 2478 2490 N/A INTRINSIC
low complexity region 2528 2552 N/A INTRINSIC
low complexity region 2742 2750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133283
Meta Mutation Damage Score 0.0638 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1A heavy chain and LC2 light chain. Expression of this gene is almost exclusively in the brain. Studies of the rat microtubule-associated protein 1A gene suggested a role in early events of spinal cord development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit Purkinje cell degeneration. Mice homozygous for a spontaneous mutation exhibit mild ataxia and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,802 E643G probably damaging Het
4430402I18Rik G T 19: 28,941,775 H195N possibly damaging Het
Abca2 T C 2: 25,444,827 V1937A probably benign Het
Acot10 A T 15: 20,666,330 N108K possibly damaging Het
Agtpbp1 A T 13: 59,500,572 M478K probably benign Het
Akirin1 G A 4: 123,736,858 S191F probably damaging Het
Aurkb T C 11: 69,048,144 probably benign Het
Cabyr T C 18: 12,744,492 probably benign Het
Ccp110 A G 7: 118,725,319 E688G probably damaging Het
Champ1 T A 8: 13,879,137 S432T probably benign Het
Crybg1 T A 10: 43,999,213 N633I probably damaging Het
Dagla A T 19: 10,269,715 probably null Het
Dkkl1 A T 7: 45,211,525 L10Q probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
E430018J23Rik A G 7: 127,393,349 Y30H probably damaging Het
Fndc7 G T 3: 108,876,670 Q208K probably benign Het
Gins4 A T 8: 23,234,780 C53S probably damaging Het
Gja8 T A 3: 96,919,035 probably benign Het
Golph3l T A 3: 95,617,423 N328K probably benign Het
Haus6 A C 4: 86,585,287 probably benign Het
Hdac5 A G 11: 102,200,563 probably benign Het
Ide A G 19: 37,277,756 Y883H unknown Het
Igf2r A G 17: 12,691,877 probably null Het
Kdm3b T C 18: 34,810,393 Y723H probably damaging Het
Kif21b G A 1: 136,151,325 probably null Het
Lancl1 A T 1: 67,021,034 N77K probably benign Het
Lyst G A 13: 13,759,378 V3554I probably benign Het
Lyst T A 13: 13,637,764 N920K probably damaging Het
Mapk7 G T 11: 61,493,908 probably benign Het
Myo10 C A 15: 25,781,118 Q154K probably damaging Het
Olfr13 C T 6: 43,174,321 L112F probably benign Het
Olfr132 A G 17: 38,130,550 I214T probably damaging Het
Pcdhgb2 G A 18: 37,692,214 V753M probably benign Het
Pnn T A 12: 59,070,227 L195Q probably damaging Het
Pot1a A G 6: 25,771,541 V227A possibly damaging Het
Ppp1r21 T A 17: 88,547,621 D109E probably benign Het
Prr15l G A 11: 96,934,762 G73S probably damaging Het
Rnf148 A G 6: 23,654,340 F219S probably benign Het
Rnpep C A 1: 135,267,026 probably benign Het
Ryr1 T C 7: 29,104,298 T643A probably damaging Het
Ryr2 A T 13: 11,945,945 C36S probably damaging Het
Shc3 G T 13: 51,442,769 T406N probably benign Het
Slit3 G T 11: 35,688,593 G1199V probably damaging Het
Sptbn5 G A 2: 120,050,120 noncoding transcript Het
St8sia6 T C 2: 13,665,442 N236D probably damaging Het
Stpg1 A T 4: 135,506,416 Q3L probably benign Het
Sult3a1 T A 10: 33,866,554 I59N probably damaging Het
Svs1 T C 6: 48,987,492 S145P probably damaging Het
Vmn1r208 T G 13: 22,772,788 I180L probably benign Het
Vmn2r51 A T 7: 10,098,320 N446K probably damaging Het
Vmn2r63 A T 7: 42,903,978 I618N probably damaging Het
Wrn T C 8: 33,322,343 N182S probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zmynd8 A G 2: 165,834,951 V249A possibly damaging Het
Zswim2 A G 2: 83,925,227 L110P probably damaging Het
Other mutations in Map1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Map1a APN 2 121299027 missense probably damaging 0.99
IGL00826:Map1a APN 2 121302276 missense possibly damaging 0.87
IGL01476:Map1a APN 2 121305207 missense probably damaging 1.00
IGL02029:Map1a APN 2 121303298 missense possibly damaging 0.57
IGL02100:Map1a APN 2 121302846 missense probably damaging 0.99
IGL02136:Map1a APN 2 121300212 missense probably damaging 1.00
IGL02146:Map1a APN 2 121299446 missense probably damaging 1.00
IGL02264:Map1a APN 2 121307313 missense probably damaging 1.00
IGL02456:Map1a APN 2 121298653 missense probably damaging 1.00
IGL02485:Map1a APN 2 121299288 missense probably damaging 1.00
IGL02535:Map1a APN 2 121302177 nonsense probably null
IGL02628:Map1a APN 2 121300104 missense probably damaging 1.00
IGL02721:Map1a APN 2 121304037 missense probably benign 0.44
IGL03273:Map1a APN 2 121300238 missense probably damaging 1.00
IGL03281:Map1a APN 2 121305060 missense probably damaging 1.00
IGL02991:Map1a UTSW 2 121301610 missense probably damaging 0.99
R0096:Map1a UTSW 2 121301505 missense probably damaging 1.00
R0096:Map1a UTSW 2 121301505 missense probably damaging 1.00
R0218:Map1a UTSW 2 121305425 missense probably benign 0.00
R0363:Map1a UTSW 2 121302044 missense probably damaging 1.00
R0450:Map1a UTSW 2 121305774 missense probably benign 0.27
R0469:Map1a UTSW 2 121305774 missense probably benign 0.27
R0477:Map1a UTSW 2 121302101 missense probably damaging 1.00
R0504:Map1a UTSW 2 121302941 missense probably benign 0.03
R0510:Map1a UTSW 2 121305774 missense probably benign 0.27
R0521:Map1a UTSW 2 121305753 missense probably damaging 1.00
R0601:Map1a UTSW 2 121298602 missense probably damaging 1.00
R0619:Map1a UTSW 2 121305255 missense probably damaging 0.96
R0633:Map1a UTSW 2 121308014 missense probably damaging 1.00
R0652:Map1a UTSW 2 121302783 missense probably benign 0.04
R0893:Map1a UTSW 2 121300533 missense probably damaging 1.00
R0960:Map1a UTSW 2 121301643 missense probably benign 0.16
R1115:Map1a UTSW 2 121307378 splice site probably null
R1166:Map1a UTSW 2 121300260 missense probably damaging 1.00
R1326:Map1a UTSW 2 121306190 nonsense probably null
R1331:Map1a UTSW 2 121306220 nonsense probably null
R1395:Map1a UTSW 2 121303925 missense probably benign 0.26
R1489:Map1a UTSW 2 121300437 missense possibly damaging 0.91
R1573:Map1a UTSW 2 121304126 missense probably benign 0.37
R1596:Map1a UTSW 2 121289765 missense probably benign 0.00
R1662:Map1a UTSW 2 121306408 missense possibly damaging 0.90
R1675:Map1a UTSW 2 121302655 nonsense probably null
R1919:Map1a UTSW 2 121307012 missense probably damaging 1.00
R2122:Map1a UTSW 2 121299446 missense probably damaging 1.00
R2126:Map1a UTSW 2 121298641 missense probably damaging 0.96
R2143:Map1a UTSW 2 121301945 missense probably damaging 1.00
R2172:Map1a UTSW 2 121307932 missense probably damaging 1.00
R2249:Map1a UTSW 2 121300287 missense probably damaging 1.00
R2254:Map1a UTSW 2 121303791 missense possibly damaging 0.71
R2255:Map1a UTSW 2 121303791 missense possibly damaging 0.71
R3834:Map1a UTSW 2 121307322 missense probably damaging 1.00
R4011:Map1a UTSW 2 121300127 missense probably damaging 1.00
R4346:Map1a UTSW 2 121301325 missense probably benign 0.13
R4842:Map1a UTSW 2 121302086 missense probably damaging 1.00
R4978:Map1a UTSW 2 121301142 missense probably benign 0.00
R4988:Map1a UTSW 2 121303050 missense probably benign 0.34
R5026:Map1a UTSW 2 121307538 missense possibly damaging 0.83
R5086:Map1a UTSW 2 121304504 missense probably damaging 1.00
R5155:Map1a UTSW 2 121302386 missense probably damaging 1.00
R5232:Map1a UTSW 2 121301985 missense probably damaging 1.00
R5311:Map1a UTSW 2 121302387 missense probably damaging 1.00
R5401:Map1a UTSW 2 121299672 missense probably damaging 1.00
R5465:Map1a UTSW 2 121306025 missense probably damaging 1.00
R5526:Map1a UTSW 2 121305662 missense probably damaging 1.00
R5642:Map1a UTSW 2 121306043 missense probably damaging 1.00
R5726:Map1a UTSW 2 121305065 missense probably damaging 1.00
R5817:Map1a UTSW 2 121298910 missense possibly damaging 0.81
R5855:Map1a UTSW 2 121303674 missense possibly damaging 0.74
R5917:Map1a UTSW 2 121305216 missense probably damaging 1.00
R5974:Map1a UTSW 2 121304376 missense probably benign 0.20
R5987:Map1a UTSW 2 121304295 missense possibly damaging 0.56
R6151:Map1a UTSW 2 121289823 missense probably benign 0.12
R6406:Map1a UTSW 2 121300743 missense probably damaging 1.00
R7014:Map1a UTSW 2 121300239 missense probably damaging 1.00
R7099:Map1a UTSW 2 121300517 missense probably benign 0.04
R7211:Map1a UTSW 2 121304643 missense probably benign 0.02
R7230:Map1a UTSW 2 121300818 missense probably damaging 1.00
R7305:Map1a UTSW 2 121299458 missense probably damaging 1.00
R7382:Map1a UTSW 2 121290785 missense probably damaging 1.00
R7524:Map1a UTSW 2 121289812 missense probably damaging 1.00
R7699:Map1a UTSW 2 121299720 missense probably damaging 1.00
R7767:Map1a UTSW 2 121302036 missense probably damaging 1.00
R7883:Map1a UTSW 2 121305372 missense probably damaging 1.00
R7896:Map1a UTSW 2 121305176 missense probably benign 0.00
R7993:Map1a UTSW 2 121304576 missense possibly damaging 0.84
R8270:Map1a UTSW 2 121299020 missense probably damaging 0.99
R8365:Map1a UTSW 2 121308047 missense probably damaging 1.00
R8428:Map1a UTSW 2 121304937 missense probably benign 0.42
R8490:Map1a UTSW 2 121304564 missense possibly damaging 0.93
R8678:Map1a UTSW 2 121307256 missense probably damaging 1.00
R8798:Map1a UTSW 2 121302287 missense probably benign 0.20
R8857:Map1a UTSW 2 121307617 missense probably damaging 1.00
R8878:Map1a UTSW 2 121307644 missense probably damaging 1.00
R8909:Map1a UTSW 2 121298910 missense probably damaging 0.99
R8917:Map1a UTSW 2 121301310 missense possibly damaging 0.93
R8947:Map1a UTSW 2 121304969 missense probably benign 0.27
R9069:Map1a UTSW 2 121303664 missense probably benign 0.15
R9198:Map1a UTSW 2 121303373 missense probably benign 0.00
R9253:Map1a UTSW 2 121302342 missense probably benign 0.00
R9290:Map1a UTSW 2 121300533 missense probably damaging 1.00
R9300:Map1a UTSW 2 121302965 missense probably damaging 1.00
R9589:Map1a UTSW 2 121305917 missense probably damaging 1.00
R9680:Map1a UTSW 2 121302384 missense probably damaging 1.00
R9792:Map1a UTSW 2 121290823 critical splice donor site probably null
R9793:Map1a UTSW 2 121290823 critical splice donor site probably null
R9795:Map1a UTSW 2 121290823 critical splice donor site probably null
RF003:Map1a UTSW 2 121306296 small insertion probably benign
RF007:Map1a UTSW 2 121306308 small insertion probably benign
RF009:Map1a UTSW 2 121306301 small insertion probably benign
RF010:Map1a UTSW 2 121306318 small insertion probably benign
RF014:Map1a UTSW 2 121306295 small insertion probably benign
RF017:Map1a UTSW 2 121306308 small insertion probably benign
RF024:Map1a UTSW 2 121306307 small insertion probably benign
RF025:Map1a UTSW 2 121306294 small insertion probably benign
RF030:Map1a UTSW 2 121306311 small insertion probably benign
RF030:Map1a UTSW 2 121306317 small insertion probably benign
RF033:Map1a UTSW 2 121306299 small insertion probably benign
RF034:Map1a UTSW 2 121306304 small insertion probably benign
RF034:Map1a UTSW 2 121306307 small insertion probably benign
RF035:Map1a UTSW 2 121306301 small insertion probably benign
RF037:Map1a UTSW 2 121306294 small insertion probably benign
RF039:Map1a UTSW 2 121306304 small insertion probably benign
RF042:Map1a UTSW 2 121306287 small insertion probably benign
RF044:Map1a UTSW 2 121306293 small insertion probably benign
RF045:Map1a UTSW 2 121306293 small insertion probably benign
RF051:Map1a UTSW 2 121306296 small insertion probably benign
RF052:Map1a UTSW 2 121306295 small insertion probably benign
RF053:Map1a UTSW 2 121306290 small insertion probably benign
RF060:Map1a UTSW 2 121306318 small insertion probably benign
RF061:Map1a UTSW 2 121306287 small insertion probably benign
Z1176:Map1a UTSW 2 121303238 missense possibly damaging 0.95
Z1177:Map1a UTSW 2 121305279 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGAAGTCACTGGGATGATGG -3'
(R):5'- CTCAGAAGAGGACCCTTCAGAC -3'

Sequencing Primer
(F):5'- TGGTACTAATGACTCAGACCTGG -3'
(R):5'- TTCAGACAAGGCTGGCG -3'
Posted On 2016-04-15