Mutagenetix > Incidental Mutations

Incidental Mutation 'R4933:Map1a'

380700

Institutional Source

Beutler Lab

Gene Symbol

Map1a

Ensembl Gene

ENSMUSG00000027254

Gene Name

microtubule-associated protein 1 A

Synonyms

Mtap1, Mtap-1, 6330416M19Rik, Mtap1a

MMRRC Submission

042533-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.311) question?

Stock #

R4933 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121289600-121310832 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 121305905 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 2163 (A2163T)

Ref Sequence

ENSEMBL: ENSMUSP00000106269 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052029] [ENSMUST00000094639] [ENSMUST00000110625] [ENSMUST00000110626] [ENSMUST00000110627] [ENSMUST00000110628] [ENSMUST00000110639]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000052029

SMART Domains

Protein: ENSMUSP00000057632
Gene: ENSMUSG00000033526

Domain	Start	End	E-Value	Type
low complexity region	35	48	N/A	INTRINSIC
PDB:3T99\|A	50	377	N/A	PDB
Pfam:His_Phos_2	390	906	8.8e-110	PFAM
low complexity region	1163	1181	N/A	INTRINSIC
coiled coil region	1402	1430	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000094639
AA Change: A2401T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000092223
Gene: ENSMUSG00000027254
AA Change: A2401T

Domain	Start	End	E-Value	Type
Blast:Lactamase_B	286	538	2e-54	BLAST
SCOP:d1eq1a_	584	699	8e-5	SMART
low complexity region	743	755	N/A	INTRINSIC
low complexity region	820	833	N/A	INTRINSIC
low complexity region	852	867	N/A	INTRINSIC
low complexity region	897	911	N/A	INTRINSIC
low complexity region	1228	1239	N/A	INTRINSIC
low complexity region	1334	1344	N/A	INTRINSIC
low complexity region	1540	1555	N/A	INTRINSIC
coiled coil region	1573	1602	N/A	INTRINSIC
internal_repeat_1	1616	1726	7.66e-6	PROSPERO
coiled coil region	1747	1771	N/A	INTRINSIC
internal_repeat_1	1774	1888	7.66e-6	PROSPERO
low complexity region	2060	2084	N/A	INTRINSIC
low complexity region	2121	2133	N/A	INTRINSIC
low complexity region	2156	2169	N/A	INTRINSIC
low complexity region	2383	2396	N/A	INTRINSIC
low complexity region	2436	2460	N/A	INTRINSIC
low complexity region	2517	2541	N/A	INTRINSIC
low complexity region	2589	2600	N/A	INTRINSIC
low complexity region	2662	2682	N/A	INTRINSIC
low complexity region	2685	2704	N/A	INTRINSIC
low complexity region	2716	2728	N/A	INTRINSIC
low complexity region	2766	2790	N/A	INTRINSIC
low complexity region	2980	2988	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110625

SMART Domains

Protein: ENSMUSP00000106255
Gene: ENSMUSG00000033526

Domain	Start	End	E-Value	Type
low complexity region	35	48	N/A	INTRINSIC
PDB:3T99\|A	50	377	N/A	PDB
Pfam:His_Phos_2	390	906	8.5e-110	PFAM
low complexity region	1142	1160	N/A	INTRINSIC
coiled coil region	1381	1409	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110626

SMART Domains

Protein: ENSMUSP00000106256
Gene: ENSMUSG00000033526

Domain	Start	End	E-Value	Type
low complexity region	35	48	N/A	INTRINSIC
PDB:3T99\|A	50	377	N/A	PDB
Pfam:His_Phos_2	390	906	1.1e-135	PFAM
low complexity region	1163	1181	N/A	INTRINSIC
coiled coil region	1402	1430	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110627

SMART Domains

Protein: ENSMUSP00000106257
Gene: ENSMUSG00000033526

Domain	Start	End	E-Value	Type
low complexity region	35	48	N/A	INTRINSIC
PDB:3T99\|A	50	377	N/A	PDB
Pfam:His_Phos_2	390	906	8.5e-110	PFAM
low complexity region	1142	1160	N/A	INTRINSIC
coiled coil region	1381	1409	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110628

SMART Domains

Protein: ENSMUSP00000106258
Gene: ENSMUSG00000033526

Domain	Start	End	E-Value	Type
low complexity region	35	48	N/A	INTRINSIC
PDB:3T99\|A	50	377	N/A	PDB
Pfam:His_Phos_2	390	886	3.9e-101	PFAM
low complexity region	1143	1161	N/A	INTRINSIC
coiled coil region	1382	1410	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110639
AA Change: A2163T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106269
Gene: ENSMUSG00000027254
AA Change: A2163T

Domain	Start	End	E-Value	Type
Blast:Lactamase_B	48	300	3e-54	BLAST
SCOP:d1eq1a_	346	461	1e-4	SMART
low complexity region	505	517	N/A	INTRINSIC
low complexity region	582	595	N/A	INTRINSIC
low complexity region	614	629	N/A	INTRINSIC
low complexity region	659	673	N/A	INTRINSIC
low complexity region	990	1001	N/A	INTRINSIC
low complexity region	1096	1106	N/A	INTRINSIC
low complexity region	1302	1317	N/A	INTRINSIC
coiled coil region	1335	1364	N/A	INTRINSIC
internal_repeat_1	1378	1488	5.43e-6	PROSPERO
coiled coil region	1509	1533	N/A	INTRINSIC
internal_repeat_1	1536	1650	5.43e-6	PROSPERO
low complexity region	1822	1846	N/A	INTRINSIC
low complexity region	1883	1895	N/A	INTRINSIC
low complexity region	1918	1931	N/A	INTRINSIC
low complexity region	2145	2158	N/A	INTRINSIC
low complexity region	2198	2222	N/A	INTRINSIC
low complexity region	2279	2303	N/A	INTRINSIC
low complexity region	2351	2362	N/A	INTRINSIC
low complexity region	2424	2444	N/A	INTRINSIC
low complexity region	2447	2466	N/A	INTRINSIC
low complexity region	2478	2490	N/A	INTRINSIC
low complexity region	2528	2552	N/A	INTRINSIC
low complexity region	2742	2750	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133283

Meta Mutation Damage Score

0.0638

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.4%
20x: 89.3%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1A heavy chain and LC2 light chain. Expression of this gene is almost exclusively in the brain. Studies of the rat microtubule-associated protein 1A gene suggested a role in early events of spinal cord development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit Purkinje cell degeneration. Mice homozygous for a spontaneous mutation exhibit mild ataxia and Purkinje cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	A	G	7: 41,626,802	E643G	probably damaging	Het
4430402I18Rik	G	T	19: 28,941,775	H195N	possibly damaging	Het
Abca2	T	C	2: 25,444,827	V1937A	probably benign	Het
Acot10	A	T	15: 20,666,330	N108K	possibly damaging	Het
Agtpbp1	A	T	13: 59,500,572	M478K	probably benign	Het
Akirin1	G	A	4: 123,736,858	S191F	probably damaging	Het
Aurkb	T	C	11: 69,048,144		probably benign	Het
Cabyr	T	C	18: 12,744,492		probably benign	Het
Ccp110	A	G	7: 118,725,319	E688G	probably damaging	Het
Champ1	T	A	8: 13,879,137	S432T	probably benign	Het
Crybg1	T	A	10: 43,999,213	N633I	probably damaging	Het
Dagla	A	T	19: 10,269,715		probably null	Het
Dkkl1	A	T	7: 45,211,525	L10Q	probably null	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
E430018J23Rik	A	G	7: 127,393,349	Y30H	probably damaging	Het
Fndc7	G	T	3: 108,876,670	Q208K	probably benign	Het
Gins4	A	T	8: 23,234,780	C53S	probably damaging	Het
Gja8	T	A	3: 96,919,035		probably benign	Het
Golph3l	T	A	3: 95,617,423	N328K	probably benign	Het
Haus6	A	C	4: 86,585,287		probably benign	Het
Hdac5	A	G	11: 102,200,563		probably benign	Het
Ide	A	G	19: 37,277,756	Y883H	unknown	Het
Igf2r	A	G	17: 12,691,877		probably null	Het
Kdm3b	T	C	18: 34,810,393	Y723H	probably damaging	Het
Kif21b	G	A	1: 136,151,325		probably null	Het
Lancl1	A	T	1: 67,021,034	N77K	probably benign	Het
Lyst	T	A	13: 13,637,764	N920K	probably damaging	Het
Lyst	G	A	13: 13,759,378	V3554I	probably benign	Het
Mapk7	G	T	11: 61,493,908		probably benign	Het
Myo10	C	A	15: 25,781,118	Q154K	probably damaging	Het
Olfr13	C	T	6: 43,174,321	L112F	probably benign	Het
Olfr132	A	G	17: 38,130,550	I214T	probably damaging	Het
Pcdhgb2	G	A	18: 37,692,214	V753M	probably benign	Het
Pnn	T	A	12: 59,070,227	L195Q	probably damaging	Het
Pot1a	A	G	6: 25,771,541	V227A	possibly damaging	Het
Ppp1r21	T	A	17: 88,547,621	D109E	probably benign	Het
Prr15l	G	A	11: 96,934,762	G73S	probably damaging	Het
Rnf148	A	G	6: 23,654,340	F219S	probably benign	Het
Rnpep	C	A	1: 135,267,026		probably benign	Het
Ryr1	T	C	7: 29,104,298	T643A	probably damaging	Het
Ryr2	A	T	13: 11,945,945	C36S	probably damaging	Het
Shc3	G	T	13: 51,442,769	T406N	probably benign	Het
Slit3	G	T	11: 35,688,593	G1199V	probably damaging	Het
Sptbn5	G	A	2: 120,050,120		noncoding transcript	Het
St8sia6	T	C	2: 13,665,442	N236D	probably damaging	Het
Stpg1	A	T	4: 135,506,416	Q3L	probably benign	Het
Sult3a1	T	A	10: 33,866,554	I59N	probably damaging	Het
Svs1	T	C	6: 48,987,492	S145P	probably damaging	Het
Vmn1r208	T	G	13: 22,772,788	I180L	probably benign	Het
Vmn2r51	A	T	7: 10,098,320	N446K	probably damaging	Het
Vmn2r63	A	T	7: 42,903,978	I618N	probably damaging	Het
Wrn	T	C	8: 33,322,343	N182S	probably benign	Het
Zfp296	G	T	7: 19,579,712	C164F	possibly damaging	Het
Zmynd8	A	G	2: 165,834,951	V249A	possibly damaging	Het
Zswim2	A	G	2: 83,925,227	L110P	probably damaging	Het

Other mutations in Map1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Map1a	APN	2	121299027	missense	probably damaging	0.99
IGL00826:Map1a	APN	2	121302276	missense	possibly damaging	0.87
IGL01476:Map1a	APN	2	121305207	missense	probably damaging	1.00
IGL02029:Map1a	APN	2	121303298	missense	possibly damaging	0.57
IGL02100:Map1a	APN	2	121302846	missense	probably damaging	0.99
IGL02136:Map1a	APN	2	121300212	missense	probably damaging	1.00
IGL02146:Map1a	APN	2	121299446	missense	probably damaging	1.00
IGL02264:Map1a	APN	2	121307313	missense	probably damaging	1.00
IGL02456:Map1a	APN	2	121298653	missense	probably damaging	1.00
IGL02485:Map1a	APN	2	121299288	missense	probably damaging	1.00
IGL02535:Map1a	APN	2	121302177	nonsense	probably null
IGL02628:Map1a	APN	2	121300104	missense	probably damaging	1.00
IGL02721:Map1a	APN	2	121304037	missense	probably benign	0.44
IGL03273:Map1a	APN	2	121300238	missense	probably damaging	1.00
IGL03281:Map1a	APN	2	121305060	missense	probably damaging	1.00
IGL02991:Map1a	UTSW	2	121301610	missense	probably damaging	0.99
R0096:Map1a	UTSW	2	121301505	missense	probably damaging	1.00
R0096:Map1a	UTSW	2	121301505	missense	probably damaging	1.00
R0218:Map1a	UTSW	2	121305425	missense	probably benign	0.00
R0363:Map1a	UTSW	2	121302044	missense	probably damaging	1.00
R0450:Map1a	UTSW	2	121305774	missense	probably benign	0.27
R0469:Map1a	UTSW	2	121305774	missense	probably benign	0.27
R0477:Map1a	UTSW	2	121302101	missense	probably damaging	1.00
R0504:Map1a	UTSW	2	121302941	missense	probably benign	0.03
R0510:Map1a	UTSW	2	121305774	missense	probably benign	0.27
R0521:Map1a	UTSW	2	121305753	missense	probably damaging	1.00
R0601:Map1a	UTSW	2	121298602	missense	probably damaging	1.00
R0619:Map1a	UTSW	2	121305255	missense	probably damaging	0.96
R0633:Map1a	UTSW	2	121308014	missense	probably damaging	1.00
R0652:Map1a	UTSW	2	121302783	missense	probably benign	0.04
R0893:Map1a	UTSW	2	121300533	missense	probably damaging	1.00
R0960:Map1a	UTSW	2	121301643	missense	probably benign	0.16
R1115:Map1a	UTSW	2	121307378	splice site	probably null
R1166:Map1a	UTSW	2	121300260	missense	probably damaging	1.00
R1326:Map1a	UTSW	2	121306190	nonsense	probably null
R1331:Map1a	UTSW	2	121306220	nonsense	probably null
R1395:Map1a	UTSW	2	121303925	missense	probably benign	0.26
R1489:Map1a	UTSW	2	121300437	missense	possibly damaging	0.91
R1573:Map1a	UTSW	2	121304126	missense	probably benign	0.37
R1596:Map1a	UTSW	2	121289765	missense	probably benign	0.00
R1662:Map1a	UTSW	2	121306408	missense	possibly damaging	0.90
R1675:Map1a	UTSW	2	121302655	nonsense	probably null
R1919:Map1a	UTSW	2	121307012	missense	probably damaging	1.00
R2122:Map1a	UTSW	2	121299446	missense	probably damaging	1.00
R2126:Map1a	UTSW	2	121298641	missense	probably damaging	0.96
R2143:Map1a	UTSW	2	121301945	missense	probably damaging	1.00
R2172:Map1a	UTSW	2	121307932	missense	probably damaging	1.00
R2249:Map1a	UTSW	2	121300287	missense	probably damaging	1.00
R2254:Map1a	UTSW	2	121303791	missense	possibly damaging	0.71
R2255:Map1a	UTSW	2	121303791	missense	possibly damaging	0.71
R3834:Map1a	UTSW	2	121307322	missense	probably damaging	1.00
R4011:Map1a	UTSW	2	121300127	missense	probably damaging	1.00
R4346:Map1a	UTSW	2	121301325	missense	probably benign	0.13
R4842:Map1a	UTSW	2	121302086	missense	probably damaging	1.00
R4978:Map1a	UTSW	2	121301142	missense	probably benign	0.00
R4988:Map1a	UTSW	2	121303050	missense	probably benign	0.34
R5026:Map1a	UTSW	2	121307538	missense	possibly damaging	0.83
R5086:Map1a	UTSW	2	121304504	missense	probably damaging	1.00
R5155:Map1a	UTSW	2	121302386	missense	probably damaging	1.00
R5232:Map1a	UTSW	2	121301985	missense	probably damaging	1.00
R5311:Map1a	UTSW	2	121302387	missense	probably damaging	1.00
R5401:Map1a	UTSW	2	121299672	missense	probably damaging	1.00
R5465:Map1a	UTSW	2	121306025	missense	probably damaging	1.00
R5526:Map1a	UTSW	2	121305662	missense	probably damaging	1.00
R5642:Map1a	UTSW	2	121306043	missense	probably damaging	1.00
R5726:Map1a	UTSW	2	121305065	missense	probably damaging	1.00
R5817:Map1a	UTSW	2	121298910	missense	possibly damaging	0.81
R5855:Map1a	UTSW	2	121303674	missense	possibly damaging	0.74
R5917:Map1a	UTSW	2	121305216	missense	probably damaging	1.00
R5974:Map1a	UTSW	2	121304376	missense	probably benign	0.20
R5987:Map1a	UTSW	2	121304295	missense	possibly damaging	0.56
R6151:Map1a	UTSW	2	121289823	missense	probably benign	0.12
R6406:Map1a	UTSW	2	121300743	missense	probably damaging	1.00
R7014:Map1a	UTSW	2	121300239	missense	probably damaging	1.00
R7099:Map1a	UTSW	2	121300517	missense	probably benign	0.04
R7211:Map1a	UTSW	2	121304643	missense	probably benign	0.02
R7230:Map1a	UTSW	2	121300818	missense	probably damaging	1.00
R7305:Map1a	UTSW	2	121299458	missense	probably damaging	1.00
R7382:Map1a	UTSW	2	121290785	missense	probably damaging	1.00
R7524:Map1a	UTSW	2	121289812	missense	probably damaging	1.00
R7699:Map1a	UTSW	2	121299720	missense	probably damaging	1.00
R7767:Map1a	UTSW	2	121302036	missense	probably damaging	1.00
R7883:Map1a	UTSW	2	121305372	missense	probably damaging	1.00
R7896:Map1a	UTSW	2	121305176	missense	probably benign	0.00
R7993:Map1a	UTSW	2	121304576	missense	possibly damaging	0.84
R8270:Map1a	UTSW	2	121299020	missense	probably damaging	0.99
R8365:Map1a	UTSW	2	121308047	missense	probably damaging	1.00
R8428:Map1a	UTSW	2	121304937	missense	probably benign	0.42
R8490:Map1a	UTSW	2	121304564	missense	possibly damaging	0.93
R8678:Map1a	UTSW	2	121307256	missense	probably damaging	1.00
R8798:Map1a	UTSW	2	121302287	missense	probably benign	0.20
R8857:Map1a	UTSW	2	121307617	missense	probably damaging	1.00
R8878:Map1a	UTSW	2	121307644	missense	probably damaging	1.00
R8909:Map1a	UTSW	2	121298910	missense	probably damaging	0.99
R8917:Map1a	UTSW	2	121301310	missense	possibly damaging	0.93
R8947:Map1a	UTSW	2	121304969	missense	probably benign	0.27
R9069:Map1a	UTSW	2	121303664	missense	probably benign	0.15
R9198:Map1a	UTSW	2	121303373	missense	probably benign	0.00
R9253:Map1a	UTSW	2	121302342	missense	probably benign	0.00
R9290:Map1a	UTSW	2	121300533	missense	probably damaging	1.00
R9300:Map1a	UTSW	2	121302965	missense	probably damaging	1.00
RF003:Map1a	UTSW	2	121306296	small insertion	probably benign
RF007:Map1a	UTSW	2	121306308	small insertion	probably benign
RF009:Map1a	UTSW	2	121306301	small insertion	probably benign
RF010:Map1a	UTSW	2	121306318	small insertion	probably benign
RF014:Map1a	UTSW	2	121306295	small insertion	probably benign
RF017:Map1a	UTSW	2	121306308	small insertion	probably benign
RF024:Map1a	UTSW	2	121306307	small insertion	probably benign
RF025:Map1a	UTSW	2	121306294	small insertion	probably benign
RF030:Map1a	UTSW	2	121306311	small insertion	probably benign
RF030:Map1a	UTSW	2	121306317	small insertion	probably benign
RF033:Map1a	UTSW	2	121306299	small insertion	probably benign
RF034:Map1a	UTSW	2	121306304	small insertion	probably benign
RF034:Map1a	UTSW	2	121306307	small insertion	probably benign
RF035:Map1a	UTSW	2	121306301	small insertion	probably benign
RF037:Map1a	UTSW	2	121306294	small insertion	probably benign
RF039:Map1a	UTSW	2	121306304	small insertion	probably benign
RF042:Map1a	UTSW	2	121306287	small insertion	probably benign
RF044:Map1a	UTSW	2	121306293	small insertion	probably benign
RF045:Map1a	UTSW	2	121306293	small insertion	probably benign
RF051:Map1a	UTSW	2	121306296	small insertion	probably benign
RF052:Map1a	UTSW	2	121306295	small insertion	probably benign
RF053:Map1a	UTSW	2	121306290	small insertion	probably benign
RF060:Map1a	UTSW	2	121306318	small insertion	probably benign
RF061:Map1a	UTSW	2	121306287	small insertion	probably benign
Z1176:Map1a	UTSW	2	121303238	missense	possibly damaging	0.95
Z1177:Map1a	UTSW	2	121305279	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CGAAGTCACTGGGATGATGG -3'
(R):5'- CTCAGAAGAGGACCCTTCAGAC -3'

Sequencing Primer
(F):5'- TGGTACTAATGACTCAGACCTGG -3'
(R):5'- TTCAGACAAGGCTGGCG -3'

Posted On

2016-04-15