Incidental Mutation 'R4933:Zmynd8'
ID 380701
Institutional Source Beutler Lab
Gene Symbol Zmynd8
Ensembl Gene ENSMUSG00000039671
Gene Name zinc finger, MYND-type containing 8
Synonyms 2010005I16Rik, ZMYND8, RACK7, 1110013E22Rik, 3632413B07Rik, Prkcbp1
MMRRC Submission 042533-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4933 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 165784152-165899016 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 165834951 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 249 (V249A)
Ref Sequence ENSEMBL: ENSMUSP00000120932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018050] [ENSMUST00000088113] [ENSMUST00000099084] [ENSMUST00000109262] [ENSMUST00000109266] [ENSMUST00000109269] [ENSMUST00000153655] [ENSMUST00000170272] [ENSMUST00000177633]
AlphaFold A2A484
Predicted Effect probably benign
Transcript: ENSMUST00000018050
AA Change: V254A

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000018050
Gene: ENSMUSG00000039671
AA Change: V254A

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 37 56 N/A INTRINSIC
PHD 90 131 2.23e-11 SMART
BROMO 147 254 1.77e-17 SMART
Pfam:PWWP 275 349 4e-12 PFAM
Pfam:DUF3544 412 624 9.8e-112 PFAM
internal_repeat_2 640 701 9.06e-5 PROSPERO
low complexity region 770 805 N/A INTRINSIC
low complexity region 853 868 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
coiled coil region 916 978 N/A INTRINSIC
Pfam:zf-MYND 988 1022 2.2e-7 PFAM
low complexity region 1055 1075 N/A INTRINSIC
low complexity region 1142 1156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088113
AA Change: V249A

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000085436
Gene: ENSMUSG00000039671
AA Change: V249A

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
PHD 85 126 2.23e-11 SMART
BROMO 142 249 1.77e-17 SMART
Pfam:PWWP 271 346 2.7e-11 PFAM
Pfam:DUF3544 408 617 2.1e-102 PFAM
internal_repeat_2 635 696 4.2e-5 PROSPERO
low complexity region 765 800 N/A INTRINSIC
low complexity region 848 863 N/A INTRINSIC
low complexity region 870 882 N/A INTRINSIC
coiled coil region 911 973 N/A INTRINSIC
low complexity region 1050 1070 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099084
AA Change: V229A

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000096683
Gene: ENSMUSG00000039671
AA Change: V229A

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 37 56 N/A INTRINSIC
PHD 65 106 2.23e-11 SMART
BROMO 122 229 1.77e-17 SMART
Pfam:PWWP 250 324 4.1e-12 PFAM
Pfam:DUF3544 387 599 1e-111 PFAM
internal_repeat_2 615 676 4.95e-5 PROSPERO
low complexity region 745 780 N/A INTRINSIC
low complexity region 819 844 N/A INTRINSIC
low complexity region 880 895 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
coiled coil region 943 1005 N/A INTRINSIC
Pfam:zf-MYND 1015 1049 2.3e-7 PFAM
low complexity region 1082 1102 N/A INTRINSIC
low complexity region 1169 1183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109262
AA Change: V229A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104885
Gene: ENSMUSG00000039671
AA Change: V229A

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 37 56 N/A INTRINSIC
PHD 65 106 2.23e-11 SMART
BROMO 122 229 1.77e-17 SMART
Pfam:PWWP 250 324 1.2e-12 PFAM
Pfam:DUF3544 387 460 3.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109266
AA Change: V274A

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104889
Gene: ENSMUSG00000039671
AA Change: V274A

DomainStartEndE-ValueType
low complexity region 6 11 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
PHD 110 151 2.23e-11 SMART
BROMO 167 274 1.77e-17 SMART
Pfam:PWWP 295 369 4.1e-12 PFAM
Pfam:DUF3544 432 644 1e-111 PFAM
internal_repeat_2 660 721 8.36e-5 PROSPERO
low complexity region 790 825 N/A INTRINSIC
low complexity region 873 888 N/A INTRINSIC
low complexity region 895 907 N/A INTRINSIC
coiled coil region 936 998 N/A INTRINSIC
Pfam:zf-MYND 1008 1042 2.3e-7 PFAM
low complexity region 1075 1095 N/A INTRINSIC
low complexity region 1162 1176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109269
AA Change: V258A

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104892
Gene: ENSMUSG00000039671
AA Change: V258A

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
low complexity region 41 60 N/A INTRINSIC
PHD 94 135 2.23e-11 SMART
BROMO 151 258 1.77e-17 SMART
Pfam:PWWP 280 355 6.6e-11 PFAM
Pfam:DUF3544 417 626 2.6e-102 PFAM
internal_repeat_2 644 705 6.15e-5 PROSPERO
low complexity region 774 809 N/A INTRINSIC
low complexity region 848 873 N/A INTRINSIC
low complexity region 909 924 N/A INTRINSIC
low complexity region 931 943 N/A INTRINSIC
coiled coil region 972 1034 N/A INTRINSIC
low complexity region 1111 1131 N/A INTRINSIC
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152682
Predicted Effect possibly damaging
Transcript: ENSMUST00000153655
AA Change: V249A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120932
Gene: ENSMUSG00000039671
AA Change: V249A

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
PHD 85 126 2.23e-11 SMART
BROMO 142 249 1.77e-17 SMART
Pfam:PWWP 270 344 3.5e-12 PFAM
Pfam:DUF3544 407 480 6.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170272
AA Change: V229A

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128680
Gene: ENSMUSG00000039671
AA Change: V229A

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 37 56 N/A INTRINSIC
PHD 65 106 2.23e-11 SMART
BROMO 122 229 1.77e-17 SMART
Pfam:PWWP 250 324 1.1e-11 PFAM
Pfam:DUF3544 387 599 1.9e-111 PFAM
internal_repeat_2 615 676 7.92e-5 PROSPERO
low complexity region 745 780 N/A INTRINSIC
low complexity region 828 843 N/A INTRINSIC
low complexity region 850 862 N/A INTRINSIC
coiled coil region 891 953 N/A INTRINSIC
Pfam:zf-MYND 963 997 1.1e-6 PFAM
low complexity region 1030 1050 N/A INTRINSIC
low complexity region 1117 1131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177633
AA Change: V249A

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000136211
Gene: ENSMUSG00000039671
AA Change: V249A

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
PHD 85 126 2.23e-11 SMART
BROMO 142 249 1.77e-17 SMART
Pfam:PWWP 270 344 9.6e-12 PFAM
Pfam:DUF3544 407 619 1.8e-111 PFAM
internal_repeat_2 635 696 6.45e-5 PROSPERO
low complexity region 765 800 N/A INTRINSIC
low complexity region 848 863 N/A INTRINSIC
low complexity region 870 882 N/A INTRINSIC
coiled coil region 911 973 N/A INTRINSIC
Pfam:zf-MYND 983 1017 6.7e-7 PFAM
low complexity region 1050 1070 N/A INTRINSIC
low complexity region 1137 1151 N/A INTRINSIC
Meta Mutation Damage Score 0.2214 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for activated C-kinase (RACK) protein. The encoded protein has been shown to bind in vitro to activated protein kinase C beta I. In addition, this protein is a cutaneous T-cell lymphoma-associated antigen. Finally, the protein contains a bromodomain and two zinc fingers, and is thought to be a transcriptional regulator. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,802 E643G probably damaging Het
4430402I18Rik G T 19: 28,941,775 H195N possibly damaging Het
Abca2 T C 2: 25,444,827 V1937A probably benign Het
Acot10 A T 15: 20,666,330 N108K possibly damaging Het
Agtpbp1 A T 13: 59,500,572 M478K probably benign Het
Akirin1 G A 4: 123,736,858 S191F probably damaging Het
Aurkb T C 11: 69,048,144 probably benign Het
Cabyr T C 18: 12,744,492 probably benign Het
Ccp110 A G 7: 118,725,319 E688G probably damaging Het
Champ1 T A 8: 13,879,137 S432T probably benign Het
Crybg1 T A 10: 43,999,213 N633I probably damaging Het
Dagla A T 19: 10,269,715 probably null Het
Dkkl1 A T 7: 45,211,525 L10Q probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
E430018J23Rik A G 7: 127,393,349 Y30H probably damaging Het
Fndc7 G T 3: 108,876,670 Q208K probably benign Het
Gins4 A T 8: 23,234,780 C53S probably damaging Het
Gja8 T A 3: 96,919,035 probably benign Het
Golph3l T A 3: 95,617,423 N328K probably benign Het
Haus6 A C 4: 86,585,287 probably benign Het
Hdac5 A G 11: 102,200,563 probably benign Het
Ide A G 19: 37,277,756 Y883H unknown Het
Igf2r A G 17: 12,691,877 probably null Het
Kdm3b T C 18: 34,810,393 Y723H probably damaging Het
Kif21b G A 1: 136,151,325 probably null Het
Lancl1 A T 1: 67,021,034 N77K probably benign Het
Lyst T A 13: 13,637,764 N920K probably damaging Het
Lyst G A 13: 13,759,378 V3554I probably benign Het
Map1a G A 2: 121,305,905 A2163T probably damaging Het
Mapk7 G T 11: 61,493,908 probably benign Het
Myo10 C A 15: 25,781,118 Q154K probably damaging Het
Olfr13 C T 6: 43,174,321 L112F probably benign Het
Olfr132 A G 17: 38,130,550 I214T probably damaging Het
Pcdhgb2 G A 18: 37,692,214 V753M probably benign Het
Pnn T A 12: 59,070,227 L195Q probably damaging Het
Pot1a A G 6: 25,771,541 V227A possibly damaging Het
Ppp1r21 T A 17: 88,547,621 D109E probably benign Het
Prr15l G A 11: 96,934,762 G73S probably damaging Het
Rnf148 A G 6: 23,654,340 F219S probably benign Het
Rnpep C A 1: 135,267,026 probably benign Het
Ryr1 T C 7: 29,104,298 T643A probably damaging Het
Ryr2 A T 13: 11,945,945 C36S probably damaging Het
Shc3 G T 13: 51,442,769 T406N probably benign Het
Slit3 G T 11: 35,688,593 G1199V probably damaging Het
Sptbn5 G A 2: 120,050,120 noncoding transcript Het
St8sia6 T C 2: 13,665,442 N236D probably damaging Het
Stpg1 A T 4: 135,506,416 Q3L probably benign Het
Sult3a1 T A 10: 33,866,554 I59N probably damaging Het
Svs1 T C 6: 48,987,492 S145P probably damaging Het
Vmn1r208 T G 13: 22,772,788 I180L probably benign Het
Vmn2r51 A T 7: 10,098,320 N446K probably damaging Het
Vmn2r63 A T 7: 42,903,978 I618N probably damaging Het
Wrn T C 8: 33,322,343 N182S probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zswim2 A G 2: 83,925,227 L110P probably damaging Het
Other mutations in Zmynd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Zmynd8 APN 2 165812814 missense probably damaging 1.00
IGL01311:Zmynd8 APN 2 165805209 missense probably damaging 1.00
IGL02317:Zmynd8 APN 2 165820572 missense possibly damaging 0.92
IGL02548:Zmynd8 APN 2 165833405 missense probably damaging 1.00
IGL02798:Zmynd8 APN 2 165852150 critical splice acceptor site probably null
IGL02933:Zmynd8 APN 2 165828318 missense possibly damaging 0.65
cain UTSW 2 165858053 critical splice donor site probably null
F5770:Zmynd8 UTSW 2 165812394 nonsense probably null
I1329:Zmynd8 UTSW 2 165828225 missense probably damaging 1.00
P0031:Zmynd8 UTSW 2 165820698 splice site probably benign
R0267:Zmynd8 UTSW 2 165828402 missense probably damaging 1.00
R0608:Zmynd8 UTSW 2 165787158 splice site probably null
R1663:Zmynd8 UTSW 2 165807885 missense probably benign 0.11
R2212:Zmynd8 UTSW 2 165815451 missense probably damaging 1.00
R3412:Zmynd8 UTSW 2 165815451 missense probably damaging 1.00
R3413:Zmynd8 UTSW 2 165815451 missense probably damaging 1.00
R3749:Zmynd8 UTSW 2 165805198 missense probably damaging 1.00
R3820:Zmynd8 UTSW 2 165815461 nonsense probably null
R3836:Zmynd8 UTSW 2 165858099 missense probably benign 0.05
R3957:Zmynd8 UTSW 2 165812475 missense probably damaging 0.99
R4379:Zmynd8 UTSW 2 165807938 splice site probably null
R4526:Zmynd8 UTSW 2 165807607 intron probably benign
R4739:Zmynd8 UTSW 2 165805329 missense probably damaging 1.00
R4838:Zmynd8 UTSW 2 165840034 nonsense probably null
R4932:Zmynd8 UTSW 2 165834951 missense possibly damaging 0.90
R4997:Zmynd8 UTSW 2 165792816 missense probably benign 0.01
R5652:Zmynd8 UTSW 2 165807698 missense probably damaging 1.00
R5741:Zmynd8 UTSW 2 165840017 missense probably damaging 1.00
R6008:Zmynd8 UTSW 2 165842787 missense possibly damaging 0.77
R6242:Zmynd8 UTSW 2 165898947 missense possibly damaging 0.91
R6332:Zmynd8 UTSW 2 165838852 missense probably damaging 1.00
R6394:Zmynd8 UTSW 2 165846023 nonsense probably null
R6772:Zmynd8 UTSW 2 165807601 missense probably benign 0.35
R6970:Zmynd8 UTSW 2 165875750 missense probably damaging 1.00
R6986:Zmynd8 UTSW 2 165833415 missense probably damaging 1.00
R7229:Zmynd8 UTSW 2 165858053 critical splice donor site probably null
R7266:Zmynd8 UTSW 2 165807572 missense possibly damaging 0.49
R7296:Zmynd8 UTSW 2 165840009 missense probably damaging 0.98
R7642:Zmynd8 UTSW 2 165812426 missense probably damaging 1.00
R7818:Zmynd8 UTSW 2 165842831 missense probably damaging 0.97
R7821:Zmynd8 UTSW 2 165881080 intron probably benign
R8135:Zmynd8 UTSW 2 165812426 missense probably damaging 1.00
R8828:Zmynd8 UTSW 2 165812546 missense probably benign 0.00
R9128:Zmynd8 UTSW 2 165858138 start codon destroyed probably null
R9200:Zmynd8 UTSW 2 165840085 missense probably benign
R9345:Zmynd8 UTSW 2 165812748 missense possibly damaging 0.85
V7580:Zmynd8 UTSW 2 165812394 nonsense probably null
V7581:Zmynd8 UTSW 2 165812394 nonsense probably null
V7583:Zmynd8 UTSW 2 165812394 nonsense probably null
Z1088:Zmynd8 UTSW 2 165828171 missense probably benign
Z1176:Zmynd8 UTSW 2 165828188 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTAGAGCTTCCCAGTCTCGTC -3'
(R):5'- TGCCTGCCCTGTAATACAAAAGAAG -3'

Sequencing Primer
(F):5'- TCTCGTAAGTCCCCGGAGAG -3'
(R):5'- CAGCCTGGTCTACAAAGTGAGTTC -3'
Posted On 2016-04-15