Mutagenetix > Incidental Mutation

Incidental Mutation 'R4933:Haus6'

380706

Institutional Source

Beutler Lab

Gene Symbol

Haus6

Ensembl Gene

ENSMUSG00000038047

Gene Name

HAUS augmin-like complex, subunit 6

Synonyms

6230416J20Rik, D4Ertd27e

MMRRC Submission

042533-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.777) question?

Stock #

R4933 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86578855-86612055 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to C at 86585287 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000070504 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070607]

AlphaFold

Q6NV99

Predicted Effect

probably benign
Transcript: ENSMUST00000070607

SMART Domains

Protein: ENSMUSP00000070504
Gene: ENSMUSG00000038047

Domain	Start	End	E-Value	Type
Pfam:HAUS6_N	14	238	1.1e-77	PFAM
low complexity region	613	624	N/A	INTRINSIC
low complexity region	771	785	N/A	INTRINSIC
low complexity region	915	927	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128381

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158333

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.4%
20x: 89.3%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the augmin complex. The augmin complex plays a role in microtubule attachment to the kinetochore and central spindle formation. This protein may have a role in efficient chromosome congression and segregation by promoting microtubule-dependent microtubule amplification. Pseudogenes of this gene are located on chromosomes 7 and 20. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E2.5 and E7.5 with delayed or incomplete clustering of microtubule-organizing centers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	A	G	7: 41,626,802	E643G	probably damaging	Het
4430402I18Rik	G	T	19: 28,941,775	H195N	possibly damaging	Het
Abca2	T	C	2: 25,444,827	V1937A	probably benign	Het
Acot10	A	T	15: 20,666,330	N108K	possibly damaging	Het
Agtpbp1	A	T	13: 59,500,572	M478K	probably benign	Het
Akirin1	G	A	4: 123,736,858	S191F	probably damaging	Het
Aurkb	T	C	11: 69,048,144		probably benign	Het
Cabyr	T	C	18: 12,744,492		probably benign	Het
Ccp110	A	G	7: 118,725,319	E688G	probably damaging	Het
Champ1	T	A	8: 13,879,137	S432T	probably benign	Het
Crybg1	T	A	10: 43,999,213	N633I	probably damaging	Het
Dagla	A	T	19: 10,269,715		probably null	Het
Dkkl1	A	T	7: 45,211,525	L10Q	probably null	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
E430018J23Rik	A	G	7: 127,393,349	Y30H	probably damaging	Het
Fndc7	G	T	3: 108,876,670	Q208K	probably benign	Het
Gins4	A	T	8: 23,234,780	C53S	probably damaging	Het
Gja8	T	A	3: 96,919,035		probably benign	Het
Golph3l	T	A	3: 95,617,423	N328K	probably benign	Het
Hdac5	A	G	11: 102,200,563		probably benign	Het
Ide	A	G	19: 37,277,756	Y883H	unknown	Het
Igf2r	A	G	17: 12,691,877		probably null	Het
Kdm3b	T	C	18: 34,810,393	Y723H	probably damaging	Het
Kif21b	G	A	1: 136,151,325		probably null	Het
Lancl1	A	T	1: 67,021,034	N77K	probably benign	Het
Lyst	T	A	13: 13,637,764	N920K	probably damaging	Het
Lyst	G	A	13: 13,759,378	V3554I	probably benign	Het
Map1a	G	A	2: 121,305,905	A2163T	probably damaging	Het
Mapk7	G	T	11: 61,493,908		probably benign	Het
Myo10	C	A	15: 25,781,118	Q154K	probably damaging	Het
Olfr13	C	T	6: 43,174,321	L112F	probably benign	Het
Olfr132	A	G	17: 38,130,550	I214T	probably damaging	Het
Pcdhgb2	G	A	18: 37,692,214	V753M	probably benign	Het
Pnn	T	A	12: 59,070,227	L195Q	probably damaging	Het
Pot1a	A	G	6: 25,771,541	V227A	possibly damaging	Het
Ppp1r21	T	A	17: 88,547,621	D109E	probably benign	Het
Prr15l	G	A	11: 96,934,762	G73S	probably damaging	Het
Rnf148	A	G	6: 23,654,340	F219S	probably benign	Het
Rnpep	C	A	1: 135,267,026		probably benign	Het
Ryr1	T	C	7: 29,104,298	T643A	probably damaging	Het
Ryr2	A	T	13: 11,945,945	C36S	probably damaging	Het
Shc3	G	T	13: 51,442,769	T406N	probably benign	Het
Slit3	G	T	11: 35,688,593	G1199V	probably damaging	Het
Sptbn5	G	A	2: 120,050,120		noncoding transcript	Het
St8sia6	T	C	2: 13,665,442	N236D	probably damaging	Het
Stpg1	A	T	4: 135,506,416	Q3L	probably benign	Het
Sult3a1	T	A	10: 33,866,554	I59N	probably damaging	Het
Svs1	T	C	6: 48,987,492	S145P	probably damaging	Het
Vmn1r208	T	G	13: 22,772,788	I180L	probably benign	Het
Vmn2r51	A	T	7: 10,098,320	N446K	probably damaging	Het
Vmn2r63	A	T	7: 42,903,978	I618N	probably damaging	Het
Wrn	T	C	8: 33,322,343	N182S	probably benign	Het
Zfp296	G	T	7: 19,579,712	C164F	possibly damaging	Het
Zmynd8	A	G	2: 165,834,951	V249A	possibly damaging	Het
Zswim2	A	G	2: 83,925,227	L110P	probably damaging	Het

Other mutations in Haus6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00570:Haus6	APN	4	86607981	missense	probably benign	0.32
IGL02307:Haus6	APN	4	86583835	missense	possibly damaging	0.53
IGL03113:Haus6	APN	4	86583106	nonsense	probably null
IGL03384:Haus6	APN	4	86583525	missense	probably benign
R0436:Haus6	UTSW	4	86585807	missense	probably benign	0.00
R0491:Haus6	UTSW	4	86602846	missense	possibly damaging	0.93
R0620:Haus6	UTSW	4	86583514	missense	possibly damaging	0.53
R1118:Haus6	UTSW	4	86585326	critical splice donor site	probably null
R1969:Haus6	UTSW	4	86604246	missense	probably damaging	0.99
R1985:Haus6	UTSW	4	86593609	missense	possibly damaging	0.96
R2213:Haus6	UTSW	4	86581992	missense	possibly damaging	0.53
R2448:Haus6	UTSW	4	86589001	missense	possibly damaging	0.53
R2567:Haus6	UTSW	4	86585885	nonsense	probably null
R2760:Haus6	UTSW	4	86583176	nonsense	probably null
R3714:Haus6	UTSW	4	86602867	missense	probably benign	0.01
R3962:Haus6	UTSW	4	86611804	missense	possibly damaging	0.85
R4180:Haus6	UTSW	4	86583574	missense	probably benign	0.00
R4736:Haus6	UTSW	4	86600749	critical splice donor site	probably null
R4738:Haus6	UTSW	4	86600749	critical splice donor site	probably null
R4929:Haus6	UTSW	4	86595433	missense	probably benign	0.03
R5027:Haus6	UTSW	4	86605696	missense	possibly damaging	0.92
R5199:Haus6	UTSW	4	86582985	missense	possibly damaging	0.85
R5240:Haus6	UTSW	4	86583178	missense	possibly damaging	0.86
R5580:Haus6	UTSW	4	86599266	missense	possibly damaging	0.73
R5781:Haus6	UTSW	4	86601263	missense	possibly damaging	0.92
R5865:Haus6	UTSW	4	86586357	missense	possibly damaging	0.73
R5926:Haus6	UTSW	4	86599316	missense	probably benign
R6154:Haus6	UTSW	4	86583756	missense	possibly damaging	0.96
R7166:Haus6	UTSW	4	86583687	missense	possibly damaging	0.72
R7183:Haus6	UTSW	4	86583752	missense	possibly damaging	0.53
R7418:Haus6	UTSW	4	86594773	missense	possibly damaging	0.73
R7843:Haus6	UTSW	4	86586341	missense	possibly damaging	0.85
R8893:Haus6	UTSW	4	86583127	missense	possibly damaging	0.73
R9386:Haus6	UTSW	4	86583864	missense	probably benign	0.33
R9449:Haus6	UTSW	4	86595428	missense	probably benign	0.00
Z1088:Haus6	UTSW	4	86602874	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- CTCAGAAGTCACAAAAGATTACTGACG -3'
(R):5'- ACTGGTTTGCAGAGGACCTG -3'

Sequencing Primer
(F):5'- CTGACGAAAGATGGCTATAAAACTTG -3'
(R):5'- CCTCTTGTAGGTTGCCAGAG -3'

Posted On

2016-04-15