Incidental Mutation 'R4933:Olfr13'
ID 380713
Institutional Source Beutler Lab
Gene Symbol Olfr13
Ensembl Gene ENSMUSG00000043605
Gene Name olfactory receptor 13
Synonyms MOR261-6, GA_x6K02T2P3E9-4384160-4383228
MMRRC Submission 042533-MU
Accession Numbers

Genbank: NM_146652; MGI: 104812

Is this an essential gene? Possibly essential (E-score: 0.510) question?
Stock # R4933 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 43172140-43177460 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 43174321 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 112 (L112F)
Ref Sequence ENSEMBL: ENSMUSP00000149893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059512] [ENSMUST00000205175] [ENSMUST00000216179]
AlphaFold P34984
Predicted Effect probably benign
Transcript: ENSMUST00000059512
AA Change: L112F

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000053813
Gene: ENSMUSG00000043605
AA Change: L112F

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 4.8e-60 PFAM
Pfam:7TM_GPCR_Srsx 34 218 1.3e-6 PFAM
Pfam:7tm_1 40 289 6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205175
SMART Domains Protein: ENSMUSP00000145490
Gene: ENSMUSG00000071481

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 7.5e-60 PFAM
Pfam:7tm_1 40 289 3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216179
AA Change: L112F

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,802 E643G probably damaging Het
4430402I18Rik G T 19: 28,941,775 H195N possibly damaging Het
Abca2 T C 2: 25,444,827 V1937A probably benign Het
Acot10 A T 15: 20,666,330 N108K possibly damaging Het
Agtpbp1 A T 13: 59,500,572 M478K probably benign Het
Akirin1 G A 4: 123,736,858 S191F probably damaging Het
Aurkb T C 11: 69,048,144 probably benign Het
Cabyr T C 18: 12,744,492 probably benign Het
Ccp110 A G 7: 118,725,319 E688G probably damaging Het
Champ1 T A 8: 13,879,137 S432T probably benign Het
Crybg1 T A 10: 43,999,213 N633I probably damaging Het
Dagla A T 19: 10,269,715 probably null Het
Dkkl1 A T 7: 45,211,525 L10Q probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
E430018J23Rik A G 7: 127,393,349 Y30H probably damaging Het
Fndc7 G T 3: 108,876,670 Q208K probably benign Het
Gins4 A T 8: 23,234,780 C53S probably damaging Het
Gja8 T A 3: 96,919,035 probably benign Het
Golph3l T A 3: 95,617,423 N328K probably benign Het
Haus6 A C 4: 86,585,287 probably benign Het
Hdac5 A G 11: 102,200,563 probably benign Het
Ide A G 19: 37,277,756 Y883H unknown Het
Igf2r A G 17: 12,691,877 probably null Het
Kdm3b T C 18: 34,810,393 Y723H probably damaging Het
Kif21b G A 1: 136,151,325 probably null Het
Lancl1 A T 1: 67,021,034 N77K probably benign Het
Lyst T A 13: 13,637,764 N920K probably damaging Het
Lyst G A 13: 13,759,378 V3554I probably benign Het
Map1a G A 2: 121,305,905 A2163T probably damaging Het
Mapk7 G T 11: 61,493,908 probably benign Het
Myo10 C A 15: 25,781,118 Q154K probably damaging Het
Olfr132 A G 17: 38,130,550 I214T probably damaging Het
Pcdhgb2 G A 18: 37,692,214 V753M probably benign Het
Pnn T A 12: 59,070,227 L195Q probably damaging Het
Pot1a A G 6: 25,771,541 V227A possibly damaging Het
Ppp1r21 T A 17: 88,547,621 D109E probably benign Het
Prr15l G A 11: 96,934,762 G73S probably damaging Het
Rnf148 A G 6: 23,654,340 F219S probably benign Het
Rnpep C A 1: 135,267,026 probably benign Het
Ryr1 T C 7: 29,104,298 T643A probably damaging Het
Ryr2 A T 13: 11,945,945 C36S probably damaging Het
Shc3 G T 13: 51,442,769 T406N probably benign Het
Slit3 G T 11: 35,688,593 G1199V probably damaging Het
Sptbn5 G A 2: 120,050,120 noncoding transcript Het
St8sia6 T C 2: 13,665,442 N236D probably damaging Het
Stpg1 A T 4: 135,506,416 Q3L probably benign Het
Sult3a1 T A 10: 33,866,554 I59N probably damaging Het
Svs1 T C 6: 48,987,492 S145P probably damaging Het
Vmn1r208 T G 13: 22,772,788 I180L probably benign Het
Vmn2r51 A T 7: 10,098,320 N446K probably damaging Het
Vmn2r63 A T 7: 42,903,978 I618N probably damaging Het
Wrn T C 8: 33,322,343 N182S probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zmynd8 A G 2: 165,834,951 V249A possibly damaging Het
Zswim2 A G 2: 83,925,227 L110P probably damaging Het
Other mutations in Olfr13
AlleleSourceChrCoordTypePredicted EffectPPH Score
N/A - 293:Olfr13 UTSW 6 43174559 missense probably benign 0.45
R0279:Olfr13 UTSW 6 43174758 missense probably benign 0.03
R0594:Olfr13 UTSW 6 43174607 missense possibly damaging 0.64
R0669:Olfr13 UTSW 6 43174004 missense probably benign 0.36
R1339:Olfr13 UTSW 6 43174610 missense probably benign 0.39
R1371:Olfr13 UTSW 6 43174300 missense probably benign 0.01
R1669:Olfr13 UTSW 6 43174821 missense probably damaging 1.00
R1832:Olfr13 UTSW 6 43174900 missense probably benign
R2136:Olfr13 UTSW 6 43174501 missense probably benign
R4358:Olfr13 UTSW 6 43174226 missense probably damaging 0.97
R4755:Olfr13 UTSW 6 43174043 missense probably benign 0.00
R5504:Olfr13 UTSW 6 43174638 nonsense probably null
R5677:Olfr13 UTSW 6 43174331 missense probably benign 0.35
R5917:Olfr13 UTSW 6 43174712 missense probably damaging 1.00
R6287:Olfr13 UTSW 6 43174435 missense probably benign 0.00
R6480:Olfr13 UTSW 6 43174066 missense probably benign 0.05
R7020:Olfr13 UTSW 6 43174162 missense possibly damaging 0.91
R7240:Olfr13 UTSW 6 43174501 missense probably benign
R8925:Olfr13 UTSW 6 43174735 missense probably benign 0.44
R8927:Olfr13 UTSW 6 43174735 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGGGGAATGGAACCATCGTG -3'
(R):5'- GTTCACTTTCTGAGACACACAG -3'

Sequencing Primer
(F):5'- AACCATCGTGGGGCTCATCTG -3'
(R):5'- TCTGAGACACACAGAAGGGTAAG -3'
Posted On 2016-04-15