Incidental Mutation 'R4933:Vmn2r63'
ID 380720
Institutional Source Beutler Lab
Gene Symbol Vmn2r63
Ensembl Gene ENSMUSG00000090751
Gene Name vomeronasal 2, receptor 63
Synonyms EG435975
MMRRC Submission 042533-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R4933 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 42903251-42933789 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 42903978 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 618 (I618N)
Ref Sequence ENSEMBL: ENSMUSP00000129089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163803]
AlphaFold E9Q0K5
Predicted Effect probably damaging
Transcript: ENSMUST00000163803
AA Change: I618N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129089
Gene: ENSMUSG00000090751
AA Change: I618N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 3.5e-43 PFAM
Pfam:NCD3G 514 567 5.1e-23 PFAM
Pfam:7tm_3 600 835 3.5e-51 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 97% (73/75)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,802 E643G probably damaging Het
4430402I18Rik G T 19: 28,941,775 H195N possibly damaging Het
Abca2 T C 2: 25,444,827 V1937A probably benign Het
Acot10 A T 15: 20,666,330 N108K possibly damaging Het
Agtpbp1 A T 13: 59,500,572 M478K probably benign Het
Akirin1 G A 4: 123,736,858 S191F probably damaging Het
Aurkb T C 11: 69,048,144 probably benign Het
Cabyr T C 18: 12,744,492 probably benign Het
Ccp110 A G 7: 118,725,319 E688G probably damaging Het
Champ1 T A 8: 13,879,137 S432T probably benign Het
Crybg1 T A 10: 43,999,213 N633I probably damaging Het
Dagla A T 19: 10,269,715 probably null Het
Dkkl1 A T 7: 45,211,525 L10Q probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
E430018J23Rik A G 7: 127,393,349 Y30H probably damaging Het
Fndc7 G T 3: 108,876,670 Q208K probably benign Het
Gins4 A T 8: 23,234,780 C53S probably damaging Het
Gja8 T A 3: 96,919,035 probably benign Het
Golph3l T A 3: 95,617,423 N328K probably benign Het
Haus6 A C 4: 86,585,287 probably benign Het
Hdac5 A G 11: 102,200,563 probably benign Het
Ide A G 19: 37,277,756 Y883H unknown Het
Igf2r A G 17: 12,691,877 probably null Het
Kdm3b T C 18: 34,810,393 Y723H probably damaging Het
Kif21b G A 1: 136,151,325 probably null Het
Lancl1 A T 1: 67,021,034 N77K probably benign Het
Lyst T A 13: 13,637,764 N920K probably damaging Het
Lyst G A 13: 13,759,378 V3554I probably benign Het
Map1a G A 2: 121,305,905 A2163T probably damaging Het
Mapk7 G T 11: 61,493,908 probably benign Het
Myo10 C A 15: 25,781,118 Q154K probably damaging Het
Olfr13 C T 6: 43,174,321 L112F probably benign Het
Olfr132 A G 17: 38,130,550 I214T probably damaging Het
Pcdhgb2 G A 18: 37,692,214 V753M probably benign Het
Pnn T A 12: 59,070,227 L195Q probably damaging Het
Pot1a A G 6: 25,771,541 V227A possibly damaging Het
Ppp1r21 T A 17: 88,547,621 D109E probably benign Het
Prr15l G A 11: 96,934,762 G73S probably damaging Het
Rnf148 A G 6: 23,654,340 F219S probably benign Het
Rnpep C A 1: 135,267,026 probably benign Het
Ryr1 T C 7: 29,104,298 T643A probably damaging Het
Ryr2 A T 13: 11,945,945 C36S probably damaging Het
Shc3 G T 13: 51,442,769 T406N probably benign Het
Slit3 G T 11: 35,688,593 G1199V probably damaging Het
Sptbn5 G A 2: 120,050,120 noncoding transcript Het
St8sia6 T C 2: 13,665,442 N236D probably damaging Het
Stpg1 A T 4: 135,506,416 Q3L probably benign Het
Sult3a1 T A 10: 33,866,554 I59N probably damaging Het
Svs1 T C 6: 48,987,492 S145P probably damaging Het
Vmn1r208 T G 13: 22,772,788 I180L probably benign Het
Vmn2r51 A T 7: 10,098,320 N446K probably damaging Het
Wrn T C 8: 33,322,343 N182S probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zmynd8 A G 2: 165,834,951 V249A possibly damaging Het
Zswim2 A G 2: 83,925,227 L110P probably damaging Het
Other mutations in Vmn2r63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Vmn2r63 APN 7 42904119 missense probably damaging 0.99
IGL01765:Vmn2r63 APN 7 42903364 missense probably benign
IGL02203:Vmn2r63 APN 7 42904008 missense probably benign 0.01
IGL02825:Vmn2r63 APN 7 42926850 critical splice donor site probably null
IGL03155:Vmn2r63 APN 7 42903454 missense probably damaging 1.00
IGL03260:Vmn2r63 APN 7 42929192 missense probably damaging 1.00
IGL03411:Vmn2r63 APN 7 42927944 missense probably benign 0.42
PIT4280001:Vmn2r63 UTSW 7 42903985 missense probably damaging 1.00
R0066:Vmn2r63 UTSW 7 42927090 splice site probably benign
R0328:Vmn2r63 UTSW 7 42903275 missense probably benign 0.09
R0344:Vmn2r63 UTSW 7 42903618 missense probably damaging 0.98
R0554:Vmn2r63 UTSW 7 42933705 nonsense probably null
R0555:Vmn2r63 UTSW 7 42928528 nonsense probably null
R0685:Vmn2r63 UTSW 7 42928010 missense probably benign 0.13
R0751:Vmn2r63 UTSW 7 42928035 missense probably damaging 1.00
R1349:Vmn2r63 UTSW 7 42929218 missense possibly damaging 0.95
R1372:Vmn2r63 UTSW 7 42929218 missense possibly damaging 0.95
R1416:Vmn2r63 UTSW 7 42927915 missense probably benign 0.00
R1502:Vmn2r63 UTSW 7 42928591 missense possibly damaging 0.62
R1563:Vmn2r63 UTSW 7 42904126 missense probably benign 0.00
R1652:Vmn2r63 UTSW 7 42928211 missense probably benign 0.32
R1693:Vmn2r63 UTSW 7 42928319 missense probably benign
R1698:Vmn2r63 UTSW 7 42933614 missense probably benign
R1753:Vmn2r63 UTSW 7 42928245 nonsense probably null
R2136:Vmn2r63 UTSW 7 42926873 missense probably damaging 0.99
R2175:Vmn2r63 UTSW 7 42933580 critical splice donor site probably null
R2261:Vmn2r63 UTSW 7 42928607 missense probably benign 0.02
R2262:Vmn2r63 UTSW 7 42928607 missense probably benign 0.02
R2263:Vmn2r63 UTSW 7 42928607 missense probably benign 0.02
R3413:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R3426:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R3427:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R3802:Vmn2r63 UTSW 7 42903405 missense probably damaging 0.99
R4319:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R4321:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R4323:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R4346:Vmn2r63 UTSW 7 42928113 missense possibly damaging 0.67
R4568:Vmn2r63 UTSW 7 42933826 splice site probably null
R4649:Vmn2r63 UTSW 7 42903690 missense possibly damaging 0.79
R4653:Vmn2r63 UTSW 7 42903690 missense possibly damaging 0.79
R4679:Vmn2r63 UTSW 7 42928120 missense probably benign 0.00
R4734:Vmn2r63 UTSW 7 42928120 missense probably benign 0.00
R4741:Vmn2r63 UTSW 7 42928120 missense probably benign 0.00
R4748:Vmn2r63 UTSW 7 42928120 missense probably benign 0.00
R4806:Vmn2r63 UTSW 7 42926890 missense probably benign 0.34
R5198:Vmn2r63 UTSW 7 42903745 missense probably benign 0.01
R5399:Vmn2r63 UTSW 7 42928277 missense probably benign
R5400:Vmn2r63 UTSW 7 42928211 missense probably benign 0.32
R6158:Vmn2r63 UTSW 7 42933680 missense probably damaging 1.00
R6185:Vmn2r63 UTSW 7 42929011 missense probably damaging 0.98
R6267:Vmn2r63 UTSW 7 42928635 splice site probably null
R6362:Vmn2r63 UTSW 7 42903297 missense probably benign
R6706:Vmn2r63 UTSW 7 42928577 missense probably damaging 1.00
R6764:Vmn2r63 UTSW 7 42903271 missense probably damaging 0.97
R7104:Vmn2r63 UTSW 7 42928535 missense possibly damaging 0.67
R7503:Vmn2r63 UTSW 7 42933590 missense probably benign 0.02
R7506:Vmn2r63 UTSW 7 42926967 missense probably damaging 1.00
R7525:Vmn2r63 UTSW 7 42926982 missense possibly damaging 0.52
R7658:Vmn2r63 UTSW 7 42925269 missense probably damaging 1.00
R7663:Vmn2r63 UTSW 7 42927042 missense probably benign 0.00
R7702:Vmn2r63 UTSW 7 42928129 missense possibly damaging 0.46
R7918:Vmn2r63 UTSW 7 42903531 missense probably damaging 1.00
R8826:Vmn2r63 UTSW 7 42927017 missense probably benign 0.38
R8973:Vmn2r63 UTSW 7 42928495 missense probably benign 0.19
R9024:Vmn2r63 UTSW 7 42928450 missense probably benign 0.14
R9154:Vmn2r63 UTSW 7 42926989 missense probably damaging 0.96
Z1088:Vmn2r63 UTSW 7 42928559 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCATTCTAGCTGGAGAGGTG -3'
(R):5'- TGTGTGCAGTGTCCAGAAAGTC -3'

Sequencing Primer
(F):5'- GTGACCTTGAATGCAGTAACC -3'
(R):5'- TGCAGTGTCCAGAAAGTCACTATG -3'
Posted On 2016-04-15