Incidental Mutation 'R4933:E430018J23Rik'
ID 380723
Institutional Source Beutler Lab
Gene Symbol E430018J23Rik
Ensembl Gene ENSMUSG00000078580
Gene Name RIKEN cDNA E430018J23 gene
Synonyms
MMRRC Submission 042533-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R4933 (G1)
Quality Score 192
Status Validated
Chromosome 7
Chromosomal Location 127389673-127393629 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 127393349 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 30 (Y30H)
Ref Sequence ENSEMBL: ENSMUSP00000126288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074249] [ENSMUST00000106303] [ENSMUST00000165495]
AlphaFold E9PZQ8
Predicted Effect probably benign
Transcript: ENSMUST00000074249
AA Change: Y30H

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073867
Gene: ENSMUSG00000078580
AA Change: Y30H

DomainStartEndE-ValueType
KRAB 22 79 4.43e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106303
AA Change: Y30H

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101910
Gene: ENSMUSG00000078580
AA Change: Y30H

DomainStartEndE-ValueType
KRAB 22 81 9.25e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122370
Predicted Effect probably damaging
Transcript: ENSMUST00000165495
AA Change: Y30H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126288
Gene: ENSMUSG00000078580
AA Change: Y30H

DomainStartEndE-ValueType
KRAB 22 82 4.09e-29 SMART
ZnF_C2H2 168 190 2.2e-2 SMART
ZnF_C2H2 196 218 4.79e-3 SMART
ZnF_C2H2 224 246 4.3e-5 SMART
ZnF_C2H2 252 274 7.9e-4 SMART
ZnF_C2H2 280 302 9.58e-3 SMART
ZnF_C2H2 308 331 2.36e-2 SMART
ZnF_C2H2 337 359 2.57e-3 SMART
ZnF_C2H2 365 387 1.69e-3 SMART
ZnF_C2H2 393 415 2.2e-2 SMART
Meta Mutation Damage Score 0.1788 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 97% (73/75)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,802 E643G probably damaging Het
4430402I18Rik G T 19: 28,941,775 H195N possibly damaging Het
Abca2 T C 2: 25,444,827 V1937A probably benign Het
Acot10 A T 15: 20,666,330 N108K possibly damaging Het
Agtpbp1 A T 13: 59,500,572 M478K probably benign Het
Akirin1 G A 4: 123,736,858 S191F probably damaging Het
Aurkb T C 11: 69,048,144 probably benign Het
Cabyr T C 18: 12,744,492 probably benign Het
Ccp110 A G 7: 118,725,319 E688G probably damaging Het
Champ1 T A 8: 13,879,137 S432T probably benign Het
Crybg1 T A 10: 43,999,213 N633I probably damaging Het
Dagla A T 19: 10,269,715 probably null Het
Dkkl1 A T 7: 45,211,525 L10Q probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fndc7 G T 3: 108,876,670 Q208K probably benign Het
Gins4 A T 8: 23,234,780 C53S probably damaging Het
Gja8 T A 3: 96,919,035 probably benign Het
Golph3l T A 3: 95,617,423 N328K probably benign Het
Haus6 A C 4: 86,585,287 probably benign Het
Hdac5 A G 11: 102,200,563 probably benign Het
Ide A G 19: 37,277,756 Y883H unknown Het
Igf2r A G 17: 12,691,877 probably null Het
Kdm3b T C 18: 34,810,393 Y723H probably damaging Het
Kif21b G A 1: 136,151,325 probably null Het
Lancl1 A T 1: 67,021,034 N77K probably benign Het
Lyst T A 13: 13,637,764 N920K probably damaging Het
Lyst G A 13: 13,759,378 V3554I probably benign Het
Map1a G A 2: 121,305,905 A2163T probably damaging Het
Mapk7 G T 11: 61,493,908 probably benign Het
Myo10 C A 15: 25,781,118 Q154K probably damaging Het
Olfr13 C T 6: 43,174,321 L112F probably benign Het
Olfr132 A G 17: 38,130,550 I214T probably damaging Het
Pcdhgb2 G A 18: 37,692,214 V753M probably benign Het
Pnn T A 12: 59,070,227 L195Q probably damaging Het
Pot1a A G 6: 25,771,541 V227A possibly damaging Het
Ppp1r21 T A 17: 88,547,621 D109E probably benign Het
Prr15l G A 11: 96,934,762 G73S probably damaging Het
Rnf148 A G 6: 23,654,340 F219S probably benign Het
Rnpep C A 1: 135,267,026 probably benign Het
Ryr1 T C 7: 29,104,298 T643A probably damaging Het
Ryr2 A T 13: 11,945,945 C36S probably damaging Het
Shc3 G T 13: 51,442,769 T406N probably benign Het
Slit3 G T 11: 35,688,593 G1199V probably damaging Het
Sptbn5 G A 2: 120,050,120 noncoding transcript Het
St8sia6 T C 2: 13,665,442 N236D probably damaging Het
Stpg1 A T 4: 135,506,416 Q3L probably benign Het
Sult3a1 T A 10: 33,866,554 I59N probably damaging Het
Svs1 T C 6: 48,987,492 S145P probably damaging Het
Vmn1r208 T G 13: 22,772,788 I180L probably benign Het
Vmn2r51 A T 7: 10,098,320 N446K probably damaging Het
Vmn2r63 A T 7: 42,903,978 I618N probably damaging Het
Wrn T C 8: 33,322,343 N182S probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zmynd8 A G 2: 165,834,951 V249A possibly damaging Het
Zswim2 A G 2: 83,925,227 L110P probably damaging Het
Other mutations in E430018J23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:E430018J23Rik APN 7 127392036 missense possibly damaging 0.92
IGL01782:E430018J23Rik APN 7 127393304 missense probably benign 0.02
IGL02174:E430018J23Rik APN 7 127392353 missense possibly damaging 0.54
IGL02882:E430018J23Rik APN 7 127392252 missense probably damaging 1.00
IGL03152:E430018J23Rik APN 7 127392297 missense probably damaging 1.00
R0552:E430018J23Rik UTSW 7 127392332 missense possibly damaging 0.92
R1828:E430018J23Rik UTSW 7 127391909 missense probably damaging 1.00
R1843:E430018J23Rik UTSW 7 127391488 missense probably benign 0.32
R1866:E430018J23Rik UTSW 7 127393331 missense probably damaging 1.00
R3429:E430018J23Rik UTSW 7 127391742 missense possibly damaging 0.79
R4433:E430018J23Rik UTSW 7 127393002 missense possibly damaging 0.75
R5292:E430018J23Rik UTSW 7 127392487 missense possibly damaging 0.48
R6218:E430018J23Rik UTSW 7 127393409 missense possibly damaging 0.85
R6667:E430018J23Rik UTSW 7 127393423 missense probably benign 0.35
R6712:E430018J23Rik UTSW 7 127392310 missense probably damaging 1.00
R7108:E430018J23Rik UTSW 7 127391523 missense probably benign 0.05
R7214:E430018J23Rik UTSW 7 127391523 missense probably benign 0.05
R7215:E430018J23Rik UTSW 7 127391523 missense probably benign 0.05
R7216:E430018J23Rik UTSW 7 127391523 missense probably benign 0.05
R7313:E430018J23Rik UTSW 7 127391684 missense probably benign 0.23
R7396:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7397:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7398:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7478:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7479:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7480:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7481:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7512:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7652:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7716:E430018J23Rik UTSW 7 127392087 missense probably benign
R7820:E430018J23Rik UTSW 7 127391436 missense possibly damaging 0.84
R7923:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7999:E430018J23Rik UTSW 7 127392428 missense probably damaging 0.98
R8097:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R8098:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R8100:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R8182:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R8184:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R8185:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R8309:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R8389:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R8433:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R8436:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R9196:E430018J23Rik UTSW 7 127391589 missense probably benign 0.02
X0022:E430018J23Rik UTSW 7 127393270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGTTACGACCACCCGTAC -3'
(R):5'- GTGCTCACGGACCTGATATATG -3'

Sequencing Primer
(F):5'- GTACCCAGGGAACTCCGATC -3'
(R):5'- GGACCTGATATATGTCCTTTCTCAG -3'
Posted On 2016-04-15