Mutagenetix > Incidental Mutations

Incidental Mutation 'R4933:Gins4'

380725

Institutional Source

Beutler Lab

Gene Symbol

Gins4

Ensembl Gene

ENSMUSG00000031546

Gene Name

GINS complex subunit 4 (Sld5 homolog)

Synonyms

2810037C03Rik, SLD5, 4933405K01Rik

MMRRC Submission

042533-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4933 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23226616-23237659 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 23234780 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 53 (C53S)

Ref Sequence

ENSEMBL: ENSMUSP00000033950 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033950]

AlphaFold

Q99LZ3

Predicted Effect

probably damaging
Transcript: ENSMUST00000033950
AA Change: C53S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000033950
Gene: ENSMUSG00000031546
AA Change: C53S

Domain	Start	End	E-Value	Type
Pfam:Sld5	20	127	5.3e-9	PFAM
Pfam:SLD5_C	165	223	4.1e-21	PFAM

Meta Mutation Damage Score

0.4512

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.4%
20x: 89.3%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The yeast heterotetrameric GINS complex is made up of Sld5, Psf1 (GINS1; MIM 610608), Psf2 (GINS2; MIM 610609), and Psf3 (GINS3; MIM 610610). The formation of the GINS complex is essential for the initiation of DNA replication in yeast and Xenopus egg extracts (Ueno et al., 2005 [PubMed 16287864]). See GINS1 for additional information about the GINS complex.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant animals do not survive past implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	A	G	7: 41,626,802	E643G	probably damaging	Het
4430402I18Rik	G	T	19: 28,941,775	H195N	possibly damaging	Het
Abca2	T	C	2: 25,444,827	V1937A	probably benign	Het
Acot10	A	T	15: 20,666,330	N108K	possibly damaging	Het
Agtpbp1	A	T	13: 59,500,572	M478K	probably benign	Het
Akirin1	G	A	4: 123,736,858	S191F	probably damaging	Het
Aurkb	T	C	11: 69,048,144		probably benign	Het
Cabyr	T	C	18: 12,744,492		probably benign	Het
Ccp110	A	G	7: 118,725,319	E688G	probably damaging	Het
Champ1	T	A	8: 13,879,137	S432T	probably benign	Het
Crybg1	T	A	10: 43,999,213	N633I	probably damaging	Het
Dagla	A	T	19: 10,269,715		probably null	Het
Dkkl1	A	T	7: 45,211,525	L10Q	probably null	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
E430018J23Rik	A	G	7: 127,393,349	Y30H	probably damaging	Het
Fndc7	G	T	3: 108,876,670	Q208K	probably benign	Het
Gja8	T	A	3: 96,919,035		probably benign	Het
Golph3l	T	A	3: 95,617,423	N328K	probably benign	Het
Haus6	A	C	4: 86,585,287		probably benign	Het
Hdac5	A	G	11: 102,200,563		probably benign	Het
Ide	A	G	19: 37,277,756	Y883H	unknown	Het
Igf2r	A	G	17: 12,691,877		probably null	Het
Kdm3b	T	C	18: 34,810,393	Y723H	probably damaging	Het
Kif21b	G	A	1: 136,151,325		probably null	Het
Lancl1	A	T	1: 67,021,034	N77K	probably benign	Het
Lyst	G	A	13: 13,759,378	V3554I	probably benign	Het
Lyst	T	A	13: 13,637,764	N920K	probably damaging	Het
Map1a	G	A	2: 121,305,905	A2163T	probably damaging	Het
Mapk7	G	T	11: 61,493,908		probably benign	Het
Myo10	C	A	15: 25,781,118	Q154K	probably damaging	Het
Olfr13	C	T	6: 43,174,321	L112F	probably benign	Het
Olfr132	A	G	17: 38,130,550	I214T	probably damaging	Het
Pcdhgb2	G	A	18: 37,692,214	V753M	probably benign	Het
Pnn	T	A	12: 59,070,227	L195Q	probably damaging	Het
Pot1a	A	G	6: 25,771,541	V227A	possibly damaging	Het
Ppp1r21	T	A	17: 88,547,621	D109E	probably benign	Het
Prr15l	G	A	11: 96,934,762	G73S	probably damaging	Het
Rnf148	A	G	6: 23,654,340	F219S	probably benign	Het
Rnpep	C	A	1: 135,267,026		probably benign	Het
Ryr1	T	C	7: 29,104,298	T643A	probably damaging	Het
Ryr2	A	T	13: 11,945,945	C36S	probably damaging	Het
Shc3	G	T	13: 51,442,769	T406N	probably benign	Het
Slit3	G	T	11: 35,688,593	G1199V	probably damaging	Het
Sptbn5	G	A	2: 120,050,120		noncoding transcript	Het
St8sia6	T	C	2: 13,665,442	N236D	probably damaging	Het
Stpg1	A	T	4: 135,506,416	Q3L	probably benign	Het
Sult3a1	T	A	10: 33,866,554	I59N	probably damaging	Het
Svs1	T	C	6: 48,987,492	S145P	probably damaging	Het
Vmn1r208	T	G	13: 22,772,788	I180L	probably benign	Het
Vmn2r51	A	T	7: 10,098,320	N446K	probably damaging	Het
Vmn2r63	A	T	7: 42,903,978	I618N	probably damaging	Het
Wrn	T	C	8: 33,322,343	N182S	probably benign	Het
Zfp296	G	T	7: 19,579,712	C164F	possibly damaging	Het
Zmynd8	A	G	2: 165,834,951	V249A	possibly damaging	Het
Zswim2	A	G	2: 83,925,227	L110P	probably damaging	Het

Other mutations in Gins4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01376:Gins4	APN	8	23227327	missense	probably benign	0.38
IGL01824:Gins4	APN	8	23234768	nonsense	probably null
IGL02304:Gins4	APN	8	23232609	missense	probably benign
IGL03194:Gins4	APN	8	23234746	splice site	probably benign
R0058:Gins4	UTSW	8	23229510	splice site	probably benign
R0058:Gins4	UTSW	8	23229510	splice site	probably benign
R0267:Gins4	UTSW	8	23229410	splice site	probably benign
R1428:Gins4	UTSW	8	23227128	missense	probably damaging	1.00
R1519:Gins4	UTSW	8	23234776	missense	probably benign	0.04
R4691:Gins4	UTSW	8	23237059	missense	probably benign	0.40
R5088:Gins4	UTSW	8	23237068	missense	possibly damaging	0.87
R8098:Gins4	UTSW	8	23237021	missense	probably benign
RF006:Gins4	UTSW	8	23227167	missense	possibly damaging	0.71
RF016:Gins4	UTSW	8	23232610	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTTCAGTCGTTCCTTTAGAGAACC -3'
(R):5'- TGGGAAGGCTGCCATACATC -3'

Sequencing Primer
(F):5'- AGTCGTTCCTTTAGAGAACCGTGAC -3'
(R):5'- ATGAGCTGTCCCCAGAGTATTCG -3'

Posted On

2016-04-15