Incidental Mutation 'R4933:Gins4'
ID 380725
Institutional Source Beutler Lab
Gene Symbol Gins4
Ensembl Gene ENSMUSG00000031546
Gene Name GINS complex subunit 4
Synonyms 2810037C03Rik, SLD5, 4933405K01Rik
MMRRC Submission 042533-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4933 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 23716632-23727675 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23724796 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 53 (C53S)
Ref Sequence ENSEMBL: ENSMUSP00000033950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033950]
AlphaFold Q99LZ3
Predicted Effect probably damaging
Transcript: ENSMUST00000033950
AA Change: C53S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033950
Gene: ENSMUSG00000031546
AA Change: C53S

DomainStartEndE-ValueType
Pfam:Sld5 20 127 5.3e-9 PFAM
Pfam:SLD5_C 165 223 4.1e-21 PFAM
Meta Mutation Damage Score 0.4512 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The yeast heterotetrameric GINS complex is made up of Sld5, Psf1 (GINS1; MIM 610608), Psf2 (GINS2; MIM 610609), and Psf3 (GINS3; MIM 610610). The formation of the GINS complex is essential for the initiation of DNA replication in yeast and Xenopus egg extracts (Ueno et al., 2005 [PubMed 16287864]). See GINS1 for additional information about the GINS complex.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant animals do not survive past implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,276,226 (GRCm39) E643G probably damaging Het
Abca2 T C 2: 25,334,839 (GRCm39) V1937A probably benign Het
Acot10 A T 15: 20,666,416 (GRCm39) N108K possibly damaging Het
Agtpbp1 A T 13: 59,648,386 (GRCm39) M478K probably benign Het
Akirin1 G A 4: 123,630,651 (GRCm39) S191F probably damaging Het
Aoc1l3 T C 6: 48,964,426 (GRCm39) S145P probably damaging Het
Aurkb T C 11: 68,938,970 (GRCm39) probably benign Het
Cabyr T C 18: 12,877,549 (GRCm39) probably benign Het
Ccp110 A G 7: 118,324,542 (GRCm39) E688G probably damaging Het
Champ1 T A 8: 13,929,137 (GRCm39) S432T probably benign Het
Crybg1 T A 10: 43,875,209 (GRCm39) N633I probably damaging Het
Dagla A T 19: 10,247,079 (GRCm39) probably null Het
Dkkl1 A T 7: 44,860,949 (GRCm39) L10Q probably null Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Fndc7 G T 3: 108,783,986 (GRCm39) Q208K probably benign Het
Gja8 T A 3: 96,826,351 (GRCm39) probably benign Het
Golph3l T A 3: 95,524,734 (GRCm39) N328K probably benign Het
Haus6 A C 4: 86,503,524 (GRCm39) probably benign Het
Hdac5 A G 11: 102,091,389 (GRCm39) probably benign Het
Ide A G 19: 37,255,155 (GRCm39) Y883H unknown Het
Igf2r A G 17: 12,910,764 (GRCm39) probably null Het
Kdm3b T C 18: 34,943,446 (GRCm39) Y723H probably damaging Het
Kif21b G A 1: 136,079,063 (GRCm39) probably null Het
Lancl1 A T 1: 67,060,193 (GRCm39) N77K probably benign Het
Lyst T A 13: 13,812,349 (GRCm39) N920K probably damaging Het
Lyst G A 13: 13,933,963 (GRCm39) V3554I probably benign Het
Map1a G A 2: 121,136,386 (GRCm39) A2163T probably damaging Het
Mapk7 G T 11: 61,384,734 (GRCm39) probably benign Het
Myo10 C A 15: 25,781,204 (GRCm39) Q154K probably damaging Het
Or2a7 C T 6: 43,151,255 (GRCm39) L112F probably benign Het
Or2h15 A G 17: 38,441,441 (GRCm39) I214T probably damaging Het
Pcdhgb2 G A 18: 37,825,267 (GRCm39) V753M probably benign Het
Pnn T A 12: 59,117,013 (GRCm39) L195Q probably damaging Het
Pot1a A G 6: 25,771,540 (GRCm39) V227A possibly damaging Het
Ppp1r21 T A 17: 88,855,049 (GRCm39) D109E probably benign Het
Prr15l G A 11: 96,825,588 (GRCm39) G73S probably damaging Het
Rnf148 A G 6: 23,654,339 (GRCm39) F219S probably benign Het
Rnpep C A 1: 135,194,764 (GRCm39) probably benign Het
Ryr1 T C 7: 28,803,723 (GRCm39) T643A probably damaging Het
Ryr2 A T 13: 11,960,831 (GRCm39) C36S probably damaging Het
Shc3 G T 13: 51,596,805 (GRCm39) T406N probably benign Het
Slit3 G T 11: 35,579,420 (GRCm39) G1199V probably damaging Het
Spata6l G T 19: 28,919,175 (GRCm39) H195N possibly damaging Het
Sptbn5 G A 2: 119,880,601 (GRCm39) noncoding transcript Het
St8sia6 T C 2: 13,670,253 (GRCm39) N236D probably damaging Het
Stpg1 A T 4: 135,233,727 (GRCm39) Q3L probably benign Het
Sult3a1 T A 10: 33,742,550 (GRCm39) I59N probably damaging Het
Vmn1r208 T G 13: 22,956,958 (GRCm39) I180L probably benign Het
Vmn2r51 A T 7: 9,832,247 (GRCm39) N446K probably damaging Het
Vmn2r63 A T 7: 42,553,402 (GRCm39) I618N probably damaging Het
Wrn T C 8: 33,812,371 (GRCm39) N182S probably benign Het
Zfp296 G T 7: 19,313,637 (GRCm39) C164F possibly damaging Het
Zfp764l1 A G 7: 126,992,521 (GRCm39) Y30H probably damaging Het
Zmynd8 A G 2: 165,676,871 (GRCm39) V249A possibly damaging Het
Zswim2 A G 2: 83,755,571 (GRCm39) L110P probably damaging Het
Other mutations in Gins4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Gins4 APN 8 23,717,343 (GRCm39) missense probably benign 0.38
IGL01824:Gins4 APN 8 23,724,784 (GRCm39) nonsense probably null
IGL02304:Gins4 APN 8 23,722,625 (GRCm39) missense probably benign
IGL03194:Gins4 APN 8 23,724,762 (GRCm39) splice site probably benign
R0058:Gins4 UTSW 8 23,719,526 (GRCm39) splice site probably benign
R0058:Gins4 UTSW 8 23,719,526 (GRCm39) splice site probably benign
R0267:Gins4 UTSW 8 23,719,426 (GRCm39) splice site probably benign
R1428:Gins4 UTSW 8 23,717,144 (GRCm39) missense probably damaging 1.00
R1519:Gins4 UTSW 8 23,724,792 (GRCm39) missense probably benign 0.04
R4691:Gins4 UTSW 8 23,727,075 (GRCm39) missense probably benign 0.40
R5088:Gins4 UTSW 8 23,727,084 (GRCm39) missense possibly damaging 0.87
R8098:Gins4 UTSW 8 23,727,037 (GRCm39) missense probably benign
R9679:Gins4 UTSW 8 23,717,132 (GRCm39) missense probably damaging 1.00
RF006:Gins4 UTSW 8 23,717,183 (GRCm39) missense possibly damaging 0.71
RF016:Gins4 UTSW 8 23,722,626 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTCAGTCGTTCCTTTAGAGAACC -3'
(R):5'- TGGGAAGGCTGCCATACATC -3'

Sequencing Primer
(F):5'- AGTCGTTCCTTTAGAGAACCGTGAC -3'
(R):5'- ATGAGCTGTCCCCAGAGTATTCG -3'
Posted On 2016-04-15