Incidental Mutation 'R4933:Wrn'
ID 380726
Institutional Source Beutler Lab
Gene Symbol Wrn
Ensembl Gene ENSMUSG00000031583
Gene Name Werner syndrome RecQ like helicase
Synonyms
MMRRC Submission 042533-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock # R4933 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 33234384-33385527 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 33322343 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 182 (N182S)
Ref Sequence ENSEMBL: ENSMUSP00000147379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033990] [ENSMUST00000033991] [ENSMUST00000211498]
AlphaFold O09053
Predicted Effect probably benign
Transcript: ENSMUST00000033990
AA Change: N425S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000033990
Gene: ENSMUSG00000031583
AA Change: N425S

DomainStartEndE-ValueType
35EXOc 47 226 1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.3e-28 SMART
HELICc 743 824 3.7e-27 SMART
RQC 923 1028 3.1e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1222 1318 2.7e-9 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000033991
AA Change: N425S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000033991
Gene: ENSMUSG00000031583
AA Change: N425S

DomainStartEndE-ValueType
35EXOc 47 226 1.1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.4e-28 SMART
HELICc 743 824 3.7e-27 SMART
Pfam:RecQ_Zn_bind 835 905 2.2e-8 PFAM
RQC 923 1028 3.2e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1223 1317 4.3e-10 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209293
Predicted Effect probably benign
Transcript: ENSMUST00000211498
AA Change: N182S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Meta Mutation Damage Score 0.0630 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RecQ subfamily and the DEAH (Asp-Glu-Ala-His) subfamily of DNA and RNA helicases. DNA helicases are involved in many aspects of DNA metabolism, including transcription, replication, recombination, and repair. This protein contains a nuclear localization signal in the C-terminus and shows a predominant nucleolar localization. It possesses an intrinsic 3' to 5' DNA helicase activity, and is also a 3' to 5' exonuclease. Based on interactions between this protein and Ku70/80 heterodimer in DNA end processing, this protein may be involved in the repair of double strand DNA breaks. Defects in this gene are the cause of Werner syndrome, an autosomal recessive disorder characterized by premature aging. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show enhanced frequency and variety of tumors in conjunction with Trp53 knockout alleles. Homozygotes also have an elevated frequency of somatic reversion of the pink-eyed dilution unstable mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,802 E643G probably damaging Het
4430402I18Rik G T 19: 28,941,775 H195N possibly damaging Het
Abca2 T C 2: 25,444,827 V1937A probably benign Het
Acot10 A T 15: 20,666,330 N108K possibly damaging Het
Agtpbp1 A T 13: 59,500,572 M478K probably benign Het
Akirin1 G A 4: 123,736,858 S191F probably damaging Het
Aurkb T C 11: 69,048,144 probably benign Het
Cabyr T C 18: 12,744,492 probably benign Het
Ccp110 A G 7: 118,725,319 E688G probably damaging Het
Champ1 T A 8: 13,879,137 S432T probably benign Het
Crybg1 T A 10: 43,999,213 N633I probably damaging Het
Dagla A T 19: 10,269,715 probably null Het
Dkkl1 A T 7: 45,211,525 L10Q probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
E430018J23Rik A G 7: 127,393,349 Y30H probably damaging Het
Fndc7 G T 3: 108,876,670 Q208K probably benign Het
Gins4 A T 8: 23,234,780 C53S probably damaging Het
Gja8 T A 3: 96,919,035 probably benign Het
Golph3l T A 3: 95,617,423 N328K probably benign Het
Haus6 A C 4: 86,585,287 probably benign Het
Hdac5 A G 11: 102,200,563 probably benign Het
Ide A G 19: 37,277,756 Y883H unknown Het
Igf2r A G 17: 12,691,877 probably null Het
Kdm3b T C 18: 34,810,393 Y723H probably damaging Het
Kif21b G A 1: 136,151,325 probably null Het
Lancl1 A T 1: 67,021,034 N77K probably benign Het
Lyst T A 13: 13,637,764 N920K probably damaging Het
Lyst G A 13: 13,759,378 V3554I probably benign Het
Map1a G A 2: 121,305,905 A2163T probably damaging Het
Mapk7 G T 11: 61,493,908 probably benign Het
Myo10 C A 15: 25,781,118 Q154K probably damaging Het
Olfr13 C T 6: 43,174,321 L112F probably benign Het
Olfr132 A G 17: 38,130,550 I214T probably damaging Het
Pcdhgb2 G A 18: 37,692,214 V753M probably benign Het
Pnn T A 12: 59,070,227 L195Q probably damaging Het
Pot1a A G 6: 25,771,541 V227A possibly damaging Het
Ppp1r21 T A 17: 88,547,621 D109E probably benign Het
Prr15l G A 11: 96,934,762 G73S probably damaging Het
Rnf148 A G 6: 23,654,340 F219S probably benign Het
Rnpep C A 1: 135,267,026 probably benign Het
Ryr1 T C 7: 29,104,298 T643A probably damaging Het
Ryr2 A T 13: 11,945,945 C36S probably damaging Het
Shc3 G T 13: 51,442,769 T406N probably benign Het
Slit3 G T 11: 35,688,593 G1199V probably damaging Het
Sptbn5 G A 2: 120,050,120 noncoding transcript Het
St8sia6 T C 2: 13,665,442 N236D probably damaging Het
Stpg1 A T 4: 135,506,416 Q3L probably benign Het
Sult3a1 T A 10: 33,866,554 I59N probably damaging Het
Svs1 T C 6: 48,987,492 S145P probably damaging Het
Vmn1r208 T G 13: 22,772,788 I180L probably benign Het
Vmn2r51 A T 7: 10,098,320 N446K probably damaging Het
Vmn2r63 A T 7: 42,903,978 I618N probably damaging Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zmynd8 A G 2: 165,834,951 V249A possibly damaging Het
Zswim2 A G 2: 83,925,227 L110P probably damaging Het
Other mutations in Wrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Wrn APN 8 33322377 splice site probably benign
IGL00661:Wrn APN 8 33319145 splice site probably benign
IGL01472:Wrn APN 8 33329172 missense possibly damaging 0.93
IGL01544:Wrn APN 8 33324526 missense probably benign 0.00
IGL01599:Wrn APN 8 33241011 missense possibly damaging 0.69
IGL01688:Wrn APN 8 33310702 splice site probably benign
IGL01916:Wrn APN 8 33257224 missense possibly damaging 0.78
IGL01925:Wrn APN 8 33319180 missense probably benign 0.42
IGL02068:Wrn APN 8 33310749 missense probably benign 0.38
IGL02084:Wrn APN 8 33285179 missense probably benign
IGL02167:Wrn APN 8 33317555 missense probably damaging 1.00
IGL02230:Wrn APN 8 33317563 missense probably damaging 1.00
IGL02717:Wrn APN 8 33343573 missense probably damaging 1.00
IGL02982:Wrn APN 8 33343066 missense probably damaging 1.00
IGL03030:Wrn APN 8 33248961 missense possibly damaging 0.94
IGL03088:Wrn APN 8 33268823 splice site probably benign
IGL03179:Wrn APN 8 33310706 splice site probably null
IGL03306:Wrn APN 8 33336121 missense probably damaging 1.00
R0004:Wrn UTSW 8 33317560 missense probably damaging 1.00
R0190:Wrn UTSW 8 33240983 missense probably benign 0.02
R0441:Wrn UTSW 8 33268750 missense probably benign 0.24
R0463:Wrn UTSW 8 33280815 missense possibly damaging 0.84
R0538:Wrn UTSW 8 33336091 missense probably damaging 0.99
R0682:Wrn UTSW 8 33267820 missense probably benign 0.00
R0729:Wrn UTSW 8 33248918 splice site probably null
R0744:Wrn UTSW 8 33295006 missense possibly damaging 0.91
R0836:Wrn UTSW 8 33295006 missense possibly damaging 0.91
R1168:Wrn UTSW 8 33316408 missense probably damaging 1.00
R1301:Wrn UTSW 8 33292686 missense probably damaging 1.00
R1352:Wrn UTSW 8 33294916 missense probably benign 0.25
R1396:Wrn UTSW 8 33268819 missense probably damaging 1.00
R1432:Wrn UTSW 8 33319141 splice site probably benign
R1523:Wrn UTSW 8 33292716 missense probably benign 0.23
R1625:Wrn UTSW 8 33329130 missense probably benign 0.01
R1664:Wrn UTSW 8 33280766 splice site probably null
R1773:Wrn UTSW 8 33343561 missense probably damaging 1.00
R1864:Wrn UTSW 8 33288864 missense probably damaging 0.99
R1868:Wrn UTSW 8 33257221 missense probably benign 0.03
R2011:Wrn UTSW 8 33236404 missense probably benign 0.02
R2075:Wrn UTSW 8 33322329 missense probably benign 0.00
R2091:Wrn UTSW 8 33267825 missense probably benign
R2213:Wrn UTSW 8 33257015 missense probably benign 0.05
R2255:Wrn UTSW 8 33329202 missense probably benign 0.13
R2276:Wrn UTSW 8 33324556 missense probably benign 0.02
R3177:Wrn UTSW 8 33317554 missense probably damaging 1.00
R3277:Wrn UTSW 8 33317554 missense probably damaging 1.00
R3779:Wrn UTSW 8 33241020 missense probably damaging 1.00
R3827:Wrn UTSW 8 33324520 missense probably benign 0.00
R4111:Wrn UTSW 8 33352155 missense probably benign 0.02
R4392:Wrn UTSW 8 33251832 missense probably damaging 0.99
R4458:Wrn UTSW 8 33294998 missense probably damaging 0.99
R4650:Wrn UTSW 8 33255509 missense probably benign 0.05
R4656:Wrn UTSW 8 33335991 splice site probably null
R4657:Wrn UTSW 8 33335991 splice site probably null
R4667:Wrn UTSW 8 33324338 missense probably benign 0.00
R4735:Wrn UTSW 8 33285222 missense probably damaging 1.00
R5104:Wrn UTSW 8 33267867 splice site probably null
R5166:Wrn UTSW 8 33352072 critical splice donor site probably null
R5279:Wrn UTSW 8 33241101 missense probably damaging 1.00
R5400:Wrn UTSW 8 33294917 missense probably benign 0.02
R5575:Wrn UTSW 8 33336130 missense probably benign 0.02
R5695:Wrn UTSW 8 33324318 missense probably benign 0.26
R5729:Wrn UTSW 8 33268778 missense probably benign 0.02
R6044:Wrn UTSW 8 33236429 missense probably damaging 1.00
R6139:Wrn UTSW 8 33353332 missense probably damaging 1.00
R6158:Wrn UTSW 8 33319172 missense probably damaging 1.00
R6192:Wrn UTSW 8 33284654 missense probably benign 0.12
R6243:Wrn UTSW 8 33284654 missense possibly damaging 0.94
R6354:Wrn UTSW 8 33343638 missense possibly damaging 0.93
R6429:Wrn UTSW 8 33342996 missense probably damaging 1.00
R6490:Wrn UTSW 8 33319220 missense probably benign 0.01
R6529:Wrn UTSW 8 33335976 splice site probably null
R6535:Wrn UTSW 8 33336103 missense probably damaging 0.99
R7001:Wrn UTSW 8 33352129 missense probably benign 0.04
R7114:Wrn UTSW 8 33285121 frame shift probably null
R7198:Wrn UTSW 8 33324318 missense probably benign 0.00
R7200:Wrn UTSW 8 33322348 missense probably benign 0.00
R7227:Wrn UTSW 8 33248946 missense probably damaging 1.00
R7299:Wrn UTSW 8 33292718 missense probably damaging 1.00
R7374:Wrn UTSW 8 33268911 missense probably damaging 1.00
R7402:Wrn UTSW 8 33248966 missense probably benign 0.00
R7404:Wrn UTSW 8 33248966 missense probably benign 0.00
R7405:Wrn UTSW 8 33248966 missense probably benign 0.00
R7464:Wrn UTSW 8 33335996 critical splice donor site probably null
R7474:Wrn UTSW 8 33329181 missense probably damaging 0.96
R7609:Wrn UTSW 8 33310713 missense possibly damaging 0.50
R7729:Wrn UTSW 8 33324426 missense probably benign 0.21
R7830:Wrn UTSW 8 33269054 missense probably damaging 0.97
R7998:Wrn UTSW 8 33292643 missense probably benign 0.10
R8239:Wrn UTSW 8 33329185 missense probably damaging 1.00
R8262:Wrn UTSW 8 33324246 missense probably benign 0.07
R8410:Wrn UTSW 8 33269020 missense probably damaging 1.00
R8480:Wrn UTSW 8 33288768 missense probably benign 0.10
R8530:Wrn UTSW 8 33280824 missense possibly damaging 0.83
R8540:Wrn UTSW 8 33352126 missense probably damaging 0.96
R8708:Wrn UTSW 8 33292643 missense probably damaging 0.96
R8783:Wrn UTSW 8 33336013 missense probably null 1.00
R8870:Wrn UTSW 8 33329192 missense probably benign 0.01
R8876:Wrn UTSW 8 33324394 missense probably benign 0.00
R9050:Wrn UTSW 8 33342993 missense probably damaging 1.00
R9329:Wrn UTSW 8 33240978 missense probably benign
RF010:Wrn UTSW 8 33288765 missense probably benign 0.13
X0017:Wrn UTSW 8 33280782 missense probably damaging 1.00
Z1176:Wrn UTSW 8 33334209 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGAACTCCCGTGAGAACTC -3'
(R):5'- TCTGTGCTCACGCTGTGAAC -3'

Sequencing Primer
(F):5'- CACCTAAGACTACTTACAGATGAGG -3'
(R):5'- GCTCACGCTGTGAACATATAAATATG -3'
Posted On 2016-04-15