Incidental Mutation 'R4933:Crybg1'
ID 380728
Institutional Source Beutler Lab
Gene Symbol Crybg1
Ensembl Gene ENSMUSG00000019866
Gene Name crystallin beta-gamma domain containing 1
Synonyms Aim1
MMRRC Submission 042533-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4933 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 43826632-44024849 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43875209 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 633 (N633I)
Ref Sequence ENSEMBL: ENSMUSP00000143429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020017] [ENSMUST00000200401]
AlphaFold A0A0G2JG52
Predicted Effect probably damaging
Transcript: ENSMUST00000020017
AA Change: N259I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020017
Gene: ENSMUSG00000019866
AA Change: N259I

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 114 121 N/A INTRINSIC
low complexity region 176 192 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 837 857 N/A INTRINSIC
XTALbg 995 1078 8.57e-9 SMART
XTALbg 1094 1175 4.73e-20 SMART
XTALbg 1189 1282 1.23e-32 SMART
XTALbg 1290 1373 9.3e-28 SMART
XTALbg 1386 1465 1.66e-24 SMART
XTALbg 1473 1553 5.29e-32 SMART
RICIN 1556 1689 5.86e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000099864
Predicted Effect probably damaging
Transcript: ENSMUST00000200401
AA Change: N633I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143429
Gene: ENSMUSG00000019866
AA Change: N633I

DomainStartEndE-ValueType
low complexity region 377 390 N/A INTRINSIC
low complexity region 488 495 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
low complexity region 810 827 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
low complexity region 1211 1231 N/A INTRINSIC
XTALbg 1369 1452 5.4e-11 SMART
XTALbg 1468 1549 2.9e-22 SMART
XTALbg 1563 1656 7.9e-35 SMART
XTALbg 1664 1747 6e-30 SMART
XTALbg 1760 1839 1.1e-26 SMART
XTALbg 1847 1927 3.3e-34 SMART
RICIN 1930 2063 3.3e-17 SMART
Meta Mutation Damage Score 0.1372 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 97% (73/75)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,276,226 (GRCm39) E643G probably damaging Het
Abca2 T C 2: 25,334,839 (GRCm39) V1937A probably benign Het
Acot10 A T 15: 20,666,416 (GRCm39) N108K possibly damaging Het
Agtpbp1 A T 13: 59,648,386 (GRCm39) M478K probably benign Het
Akirin1 G A 4: 123,630,651 (GRCm39) S191F probably damaging Het
Aoc1l3 T C 6: 48,964,426 (GRCm39) S145P probably damaging Het
Aurkb T C 11: 68,938,970 (GRCm39) probably benign Het
Cabyr T C 18: 12,877,549 (GRCm39) probably benign Het
Ccp110 A G 7: 118,324,542 (GRCm39) E688G probably damaging Het
Champ1 T A 8: 13,929,137 (GRCm39) S432T probably benign Het
Dagla A T 19: 10,247,079 (GRCm39) probably null Het
Dkkl1 A T 7: 44,860,949 (GRCm39) L10Q probably null Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Fndc7 G T 3: 108,783,986 (GRCm39) Q208K probably benign Het
Gins4 A T 8: 23,724,796 (GRCm39) C53S probably damaging Het
Gja8 T A 3: 96,826,351 (GRCm39) probably benign Het
Golph3l T A 3: 95,524,734 (GRCm39) N328K probably benign Het
Haus6 A C 4: 86,503,524 (GRCm39) probably benign Het
Hdac5 A G 11: 102,091,389 (GRCm39) probably benign Het
Ide A G 19: 37,255,155 (GRCm39) Y883H unknown Het
Igf2r A G 17: 12,910,764 (GRCm39) probably null Het
Kdm3b T C 18: 34,943,446 (GRCm39) Y723H probably damaging Het
Kif21b G A 1: 136,079,063 (GRCm39) probably null Het
Lancl1 A T 1: 67,060,193 (GRCm39) N77K probably benign Het
Lyst T A 13: 13,812,349 (GRCm39) N920K probably damaging Het
Lyst G A 13: 13,933,963 (GRCm39) V3554I probably benign Het
Map1a G A 2: 121,136,386 (GRCm39) A2163T probably damaging Het
Mapk7 G T 11: 61,384,734 (GRCm39) probably benign Het
Myo10 C A 15: 25,781,204 (GRCm39) Q154K probably damaging Het
Or2a7 C T 6: 43,151,255 (GRCm39) L112F probably benign Het
Or2h15 A G 17: 38,441,441 (GRCm39) I214T probably damaging Het
Pcdhgb2 G A 18: 37,825,267 (GRCm39) V753M probably benign Het
Pnn T A 12: 59,117,013 (GRCm39) L195Q probably damaging Het
Pot1a A G 6: 25,771,540 (GRCm39) V227A possibly damaging Het
Ppp1r21 T A 17: 88,855,049 (GRCm39) D109E probably benign Het
Prr15l G A 11: 96,825,588 (GRCm39) G73S probably damaging Het
Rnf148 A G 6: 23,654,339 (GRCm39) F219S probably benign Het
Rnpep C A 1: 135,194,764 (GRCm39) probably benign Het
Ryr1 T C 7: 28,803,723 (GRCm39) T643A probably damaging Het
Ryr2 A T 13: 11,960,831 (GRCm39) C36S probably damaging Het
Shc3 G T 13: 51,596,805 (GRCm39) T406N probably benign Het
Slit3 G T 11: 35,579,420 (GRCm39) G1199V probably damaging Het
Spata6l G T 19: 28,919,175 (GRCm39) H195N possibly damaging Het
Sptbn5 G A 2: 119,880,601 (GRCm39) noncoding transcript Het
St8sia6 T C 2: 13,670,253 (GRCm39) N236D probably damaging Het
Stpg1 A T 4: 135,233,727 (GRCm39) Q3L probably benign Het
Sult3a1 T A 10: 33,742,550 (GRCm39) I59N probably damaging Het
Vmn1r208 T G 13: 22,956,958 (GRCm39) I180L probably benign Het
Vmn2r51 A T 7: 9,832,247 (GRCm39) N446K probably damaging Het
Vmn2r63 A T 7: 42,553,402 (GRCm39) I618N probably damaging Het
Wrn T C 8: 33,812,371 (GRCm39) N182S probably benign Het
Zfp296 G T 7: 19,313,637 (GRCm39) C164F possibly damaging Het
Zfp764l1 A G 7: 126,992,521 (GRCm39) Y30H probably damaging Het
Zmynd8 A G 2: 165,676,871 (GRCm39) V249A possibly damaging Het
Zswim2 A G 2: 83,755,571 (GRCm39) L110P probably damaging Het
Other mutations in Crybg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Crybg1 APN 10 43,868,505 (GRCm39) missense probably damaging 1.00
IGL00502:Crybg1 APN 10 43,834,309 (GRCm39) missense probably damaging 1.00
IGL00848:Crybg1 APN 10 43,843,814 (GRCm39) splice site probably null
IGL01287:Crybg1 APN 10 43,868,490 (GRCm39) missense possibly damaging 0.53
IGL01310:Crybg1 APN 10 43,879,596 (GRCm39) missense probably damaging 0.99
IGL01310:Crybg1 APN 10 43,851,054 (GRCm39) missense possibly damaging 0.95
IGL02683:Crybg1 APN 10 43,865,212 (GRCm39) missense possibly damaging 0.64
IGL03095:Crybg1 APN 10 43,865,245 (GRCm39) missense probably damaging 1.00
R0062:Crybg1 UTSW 10 43,873,902 (GRCm39) missense probably damaging 0.98
R0142:Crybg1 UTSW 10 43,875,059 (GRCm39) missense possibly damaging 0.83
R0294:Crybg1 UTSW 10 43,862,372 (GRCm39) missense probably damaging 1.00
R0539:Crybg1 UTSW 10 43,874,894 (GRCm39) missense probably benign 0.03
R0781:Crybg1 UTSW 10 43,875,089 (GRCm39) missense possibly damaging 0.95
R1110:Crybg1 UTSW 10 43,875,089 (GRCm39) missense possibly damaging 0.95
R1189:Crybg1 UTSW 10 43,874,790 (GRCm39) missense probably damaging 1.00
R1428:Crybg1 UTSW 10 43,851,074 (GRCm39) missense probably benign 0.33
R1521:Crybg1 UTSW 10 43,874,412 (GRCm39) missense probably damaging 1.00
R1688:Crybg1 UTSW 10 43,849,794 (GRCm39) missense probably damaging 1.00
R1728:Crybg1 UTSW 10 43,880,015 (GRCm39) missense probably damaging 0.97
R1756:Crybg1 UTSW 10 43,862,275 (GRCm39) missense probably damaging 1.00
R1773:Crybg1 UTSW 10 43,868,544 (GRCm39) missense possibly damaging 0.91
R1784:Crybg1 UTSW 10 43,880,015 (GRCm39) missense probably damaging 0.97
R1850:Crybg1 UTSW 10 43,873,670 (GRCm39) missense probably damaging 1.00
R1911:Crybg1 UTSW 10 43,873,673 (GRCm39) missense possibly damaging 0.47
R1920:Crybg1 UTSW 10 43,873,544 (GRCm39) missense probably damaging 1.00
R1964:Crybg1 UTSW 10 43,834,326 (GRCm39) missense probably damaging 1.00
R2298:Crybg1 UTSW 10 43,875,218 (GRCm39) missense probably damaging 1.00
R3617:Crybg1 UTSW 10 43,832,782 (GRCm39) missense possibly damaging 0.82
R3913:Crybg1 UTSW 10 43,874,759 (GRCm39) missense possibly damaging 0.95
R4081:Crybg1 UTSW 10 43,851,035 (GRCm39) missense probably damaging 1.00
R4116:Crybg1 UTSW 10 43,875,158 (GRCm39) missense possibly damaging 0.91
R4409:Crybg1 UTSW 10 43,874,754 (GRCm39) missense possibly damaging 0.94
R4583:Crybg1 UTSW 10 43,873,616 (GRCm39) missense probably damaging 1.00
R4721:Crybg1 UTSW 10 43,873,883 (GRCm39) missense probably damaging 1.00
R4818:Crybg1 UTSW 10 43,874,583 (GRCm39) missense probably benign 0.00
R4859:Crybg1 UTSW 10 43,868,565 (GRCm39) missense probably damaging 1.00
R5028:Crybg1 UTSW 10 43,874,208 (GRCm39) missense possibly damaging 0.74
R5057:Crybg1 UTSW 10 43,865,104 (GRCm39) nonsense probably null
R5102:Crybg1 UTSW 10 43,873,832 (GRCm39) missense probably damaging 1.00
R5103:Crybg1 UTSW 10 43,873,944 (GRCm39) missense probably damaging 1.00
R5137:Crybg1 UTSW 10 43,834,332 (GRCm39) missense probably damaging 1.00
R5212:Crybg1 UTSW 10 43,843,739 (GRCm39) missense possibly damaging 0.95
R5307:Crybg1 UTSW 10 43,879,710 (GRCm39) missense probably benign 0.00
R5353:Crybg1 UTSW 10 43,849,661 (GRCm39) missense probably damaging 1.00
R5463:Crybg1 UTSW 10 43,879,689 (GRCm39) nonsense probably null
R5503:Crybg1 UTSW 10 43,874,762 (GRCm39) missense probably benign 0.00
R5583:Crybg1 UTSW 10 43,879,506 (GRCm39) missense probably benign 0.01
R5835:Crybg1 UTSW 10 43,851,129 (GRCm39) missense probably benign 0.28
R6021:Crybg1 UTSW 10 43,873,534 (GRCm39) missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43,832,756 (GRCm39) missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43,832,756 (GRCm39) missense probably damaging 1.00
R6277:Crybg1 UTSW 10 43,873,255 (GRCm39) missense probably benign 0.03
R6338:Crybg1 UTSW 10 43,868,505 (GRCm39) missense probably damaging 1.00
R6348:Crybg1 UTSW 10 43,879,947 (GRCm39) missense probably damaging 1.00
R6514:Crybg1 UTSW 10 43,873,211 (GRCm39) missense probably damaging 1.00
R6785:Crybg1 UTSW 10 43,875,167 (GRCm39) missense probably benign 0.00
R6804:Crybg1 UTSW 10 43,842,337 (GRCm39) missense probably damaging 1.00
R6938:Crybg1 UTSW 10 43,873,379 (GRCm39) missense probably benign 0.01
R6983:Crybg1 UTSW 10 43,875,338 (GRCm39) missense probably damaging 1.00
R7002:Crybg1 UTSW 10 43,874,831 (GRCm39) missense probably damaging 1.00
R7153:Crybg1 UTSW 10 43,840,662 (GRCm39) missense possibly damaging 0.64
R7271:Crybg1 UTSW 10 43,873,619 (GRCm39) nonsense probably null
R7293:Crybg1 UTSW 10 43,879,428 (GRCm39) missense probably damaging 1.00
R7304:Crybg1 UTSW 10 43,873,254 (GRCm39) missense probably benign 0.05
R7313:Crybg1 UTSW 10 43,865,107 (GRCm39) missense probably damaging 0.98
R7373:Crybg1 UTSW 10 43,880,136 (GRCm39) missense probably benign 0.00
R7449:Crybg1 UTSW 10 43,880,515 (GRCm39) missense probably benign
R7530:Crybg1 UTSW 10 43,875,069 (GRCm39) missense possibly damaging 0.62
R7660:Crybg1 UTSW 10 43,874,831 (GRCm39) missense probably damaging 0.97
R7701:Crybg1 UTSW 10 43,865,139 (GRCm39) missense probably benign 0.06
R8181:Crybg1 UTSW 10 43,862,322 (GRCm39) missense probably damaging 0.98
R8237:Crybg1 UTSW 10 43,842,376 (GRCm39) nonsense probably null
R8359:Crybg1 UTSW 10 43,868,538 (GRCm39) missense probably benign 0.03
R8751:Crybg1 UTSW 10 43,880,838 (GRCm39) missense probably benign 0.04
R8809:Crybg1 UTSW 10 43,879,428 (GRCm39) missense probably damaging 1.00
R9017:Crybg1 UTSW 10 43,880,477 (GRCm39) missense probably benign 0.00
R9069:Crybg1 UTSW 10 43,874,103 (GRCm39) missense probably benign 0.30
R9099:Crybg1 UTSW 10 43,874,844 (GRCm39) missense probably benign 0.01
R9118:Crybg1 UTSW 10 43,879,925 (GRCm39) missense possibly damaging 0.56
R9185:Crybg1 UTSW 10 43,880,091 (GRCm39) missense probably benign 0.04
R9486:Crybg1 UTSW 10 43,880,145 (GRCm39) start gained probably benign
R9561:Crybg1 UTSW 10 43,873,428 (GRCm39) missense probably benign 0.00
RF005:Crybg1 UTSW 10 43,880,741 (GRCm39) missense probably benign 0.03
RF024:Crybg1 UTSW 10 43,880,741 (GRCm39) missense probably benign 0.03
X0065:Crybg1 UTSW 10 43,868,522 (GRCm39) synonymous silent
Z1088:Crybg1 UTSW 10 43,873,307 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GACGAATCTCTTCTCTGGGGAC -3'
(R):5'- TAACACCAGGCTGCTAACTGC -3'

Sequencing Primer
(F):5'- AGATGGCTCTTTGACCACCAG -3'
(R):5'- GCTGCTAACTGCCCTGTTG -3'
Posted On 2016-04-15