Mutagenetix > Incidental Mutation

Incidental Mutation 'R4933:Slit3'

380729

Institutional Source

Beutler Lab

Gene Symbol

Slit3

Ensembl Gene

ENSMUSG00000056427

Gene Name

slit guidance ligand 3

Synonyms

Slit1

MMRRC Submission

042533-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.874) question?

Stock #

R4933 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

35121224-35708507 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 35688593 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Valine at position 1199 (G1199V)

Ref Sequence

ENSEMBL: ENSMUSP00000066857 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069837]

AlphaFold

Q9WVB4

Predicted Effect

probably damaging
Transcript: ENSMUST00000069837
AA Change: G1199V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000066857
Gene: ENSMUSG00000056427
AA Change: G1199V

Domain	Start	End	E-Value	Type
low complexity region	2	23	N/A	INTRINSIC
LRRNT	33	65	2.12e-8	SMART
LRR	59	83	1.37e2	SMART
LRR_TYP	84	107	1.12e-3	SMART
LRR_TYP	108	131	7.78e-3	SMART
LRR_TYP	132	155	5.42e-2	SMART
LRR	156	179	5.88e0	SMART
LRR	180	203	7.55e-1	SMART
LRRCT	215	264	1.33e-6	SMART
LRRNT	279	311	6.79e-7	SMART
LRR	305	329	1.16e2	SMART
LRR	330	353	1.26e1	SMART
LRR_TYP	354	377	2.79e-4	SMART
LRR	378	401	4.05e-1	SMART
LRR	402	425	4.05e-1	SMART
LRRCT	437	486	7.75e-8	SMART
LRRNT	504	536	1.95e-7	SMART
LRR_TYP	556	579	7.49e-5	SMART
LRR	581	603	6.41e1	SMART
LRR_TYP	604	627	2.53e-2	SMART
LRR	628	651	1.76e-1	SMART
LRRCT	663	712	2.52e-7	SMART
LRRNT	724	756	3e-8	SMART
LRR	774	797	2.14e0	SMART
LRR_TYP	798	821	2.95e-3	SMART
LRR_TYP	822	845	2.43e-4	SMART
LRRCT	857	906	1.12e-13	SMART
EGF	919	953	6.86e-4	SMART
EGF	958	994	8.84e-7	SMART
EGF	999	1032	1.13e-4	SMART
EGF	1037	1072	2.3e-5	SMART
EGF_CA	1074	1110	5.92e-8	SMART
EGF	1122	1155	3.79e-6	SMART
LamG	1178	1314	3.16e-34	SMART
EGF	1331	1365	2.19e-2	SMART
EGF	1371	1403	1.13e-4	SMART
EGF	1411	1444	5.57e-4	SMART
CT	1455	1523	4.56e-5	SMART

Meta Mutation Damage Score

0.7931

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.4%
20x: 89.3%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is secreted, likely interacting with roundabout homolog receptors to effect cell migration. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a gene trap allele show congenital diaphragmatic hernia (CDH), variable renal defects and enlarged heart right ventricles. Mice homozygous for either of two reporter alleles show diaphragm dysgenesis and die prematurely; those with end-stage CDH show dyspnea and lung congestion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	A	G	7: 41,626,802	E643G	probably damaging	Het
4430402I18Rik	G	T	19: 28,941,775	H195N	possibly damaging	Het
Abca2	T	C	2: 25,444,827	V1937A	probably benign	Het
Acot10	A	T	15: 20,666,330	N108K	possibly damaging	Het
Agtpbp1	A	T	13: 59,500,572	M478K	probably benign	Het
Akirin1	G	A	4: 123,736,858	S191F	probably damaging	Het
Aurkb	T	C	11: 69,048,144		probably benign	Het
Cabyr	T	C	18: 12,744,492		probably benign	Het
Ccp110	A	G	7: 118,725,319	E688G	probably damaging	Het
Champ1	T	A	8: 13,879,137	S432T	probably benign	Het
Crybg1	T	A	10: 43,999,213	N633I	probably damaging	Het
Dagla	A	T	19: 10,269,715		probably null	Het
Dkkl1	A	T	7: 45,211,525	L10Q	probably null	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
E430018J23Rik	A	G	7: 127,393,349	Y30H	probably damaging	Het
Fndc7	G	T	3: 108,876,670	Q208K	probably benign	Het
Gins4	A	T	8: 23,234,780	C53S	probably damaging	Het
Gja8	T	A	3: 96,919,035		probably benign	Het
Golph3l	T	A	3: 95,617,423	N328K	probably benign	Het
Haus6	A	C	4: 86,585,287		probably benign	Het
Hdac5	A	G	11: 102,200,563		probably benign	Het
Ide	A	G	19: 37,277,756	Y883H	unknown	Het
Igf2r	A	G	17: 12,691,877		probably null	Het
Kdm3b	T	C	18: 34,810,393	Y723H	probably damaging	Het
Kif21b	G	A	1: 136,151,325		probably null	Het
Lancl1	A	T	1: 67,021,034	N77K	probably benign	Het
Lyst	T	A	13: 13,637,764	N920K	probably damaging	Het
Lyst	G	A	13: 13,759,378	V3554I	probably benign	Het
Map1a	G	A	2: 121,305,905	A2163T	probably damaging	Het
Mapk7	G	T	11: 61,493,908		probably benign	Het
Myo10	C	A	15: 25,781,118	Q154K	probably damaging	Het
Olfr13	C	T	6: 43,174,321	L112F	probably benign	Het
Olfr132	A	G	17: 38,130,550	I214T	probably damaging	Het
Pcdhgb2	G	A	18: 37,692,214	V753M	probably benign	Het
Pnn	T	A	12: 59,070,227	L195Q	probably damaging	Het
Pot1a	A	G	6: 25,771,541	V227A	possibly damaging	Het
Ppp1r21	T	A	17: 88,547,621	D109E	probably benign	Het
Prr15l	G	A	11: 96,934,762	G73S	probably damaging	Het
Rnf148	A	G	6: 23,654,340	F219S	probably benign	Het
Rnpep	C	A	1: 135,267,026		probably benign	Het
Ryr1	T	C	7: 29,104,298	T643A	probably damaging	Het
Ryr2	A	T	13: 11,945,945	C36S	probably damaging	Het
Shc3	G	T	13: 51,442,769	T406N	probably benign	Het
Sptbn5	G	A	2: 120,050,120		noncoding transcript	Het
St8sia6	T	C	2: 13,665,442	N236D	probably damaging	Het
Stpg1	A	T	4: 135,506,416	Q3L	probably benign	Het
Sult3a1	T	A	10: 33,866,554	I59N	probably damaging	Het
Svs1	T	C	6: 48,987,492	S145P	probably damaging	Het
Vmn1r208	T	G	13: 22,772,788	I180L	probably benign	Het
Vmn2r51	A	T	7: 10,098,320	N446K	probably damaging	Het
Vmn2r63	A	T	7: 42,903,978	I618N	probably damaging	Het
Wrn	T	C	8: 33,322,343	N182S	probably benign	Het
Zfp296	G	T	7: 19,579,712	C164F	possibly damaging	Het
Zmynd8	A	G	2: 165,834,951	V249A	possibly damaging	Het
Zswim2	A	G	2: 83,925,227	L110P	probably damaging	Het

Other mutations in Slit3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00731:Slit3	APN	11	35622154	missense	probably damaging	1.00
IGL01324:Slit3	APN	11	35610702	missense	probably damaging	1.00
IGL01612:Slit3	APN	11	35700384	missense	possibly damaging	0.95
IGL02145:Slit3	APN	11	35629742	missense	probably damaging	0.99
IGL02146:Slit3	APN	11	35234848	missense	possibly damaging	0.71
IGL02430:Slit3	APN	11	35177774	splice site	probably null
IGL02528:Slit3	APN	11	35578974	missense	probably benign
IGL02530:Slit3	APN	11	35708142	makesense	probably null
IGL02640:Slit3	APN	11	35700345	missense	probably benign	0.10
IGL02819:Slit3	APN	11	35171590	missense	possibly damaging	0.71
IGL02839:Slit3	APN	11	35649047	missense	possibly damaging	0.46
IGL03150:Slit3	APN	11	35508257	missense	possibly damaging	0.88
IGL03161:Slit3	APN	11	35700414	missense	probably benign	0.10
IGL03336:Slit3	APN	11	35670101	missense	probably damaging	0.97
Bloated	UTSW	11	35633952	missense	possibly damaging	0.55
Quellung	UTSW	11	35651820	critical splice donor site	probably null
IGL02988:Slit3	UTSW	11	35708063	missense	probably damaging	0.99
PIT4791001:Slit3	UTSW	11	35661245	missense	possibly damaging	0.85
R0013:Slit3	UTSW	11	35707918	missense	probably benign
R0013:Slit3	UTSW	11	35707918	missense	probably benign
R0334:Slit3	UTSW	11	35579101	missense	probably damaging	0.97
R0385:Slit3	UTSW	11	35700282	missense	probably damaging	0.98
R0840:Slit3	UTSW	11	35623436	splice site	probably benign
R1065:Slit3	UTSW	11	35121635	missense	possibly damaging	0.86
R1364:Slit3	UTSW	11	35670107	missense	probably benign
R1476:Slit3	UTSW	11	35686299	missense	probably damaging	0.97
R1508:Slit3	UTSW	11	35570621	missense	probably damaging	1.00
R1665:Slit3	UTSW	11	35234906	missense	possibly damaging	0.71
R1692:Slit3	UTSW	11	35659344	missense	probably damaging	1.00
R1696:Slit3	UTSW	11	35675923	missense	probably damaging	0.99
R1727:Slit3	UTSW	11	35629832	missense	probably damaging	1.00
R1752:Slit3	UTSW	11	35564653	missense	probably damaging	0.98
R1970:Slit3	UTSW	11	35630841	critical splice acceptor site	probably null
R2077:Slit3	UTSW	11	35544748	missense	possibly damaging	0.88
R2126:Slit3	UTSW	11	35688679	missense	probably damaging	1.00
R2143:Slit3	UTSW	11	35612261	splice site	probably null
R2162:Slit3	UTSW	11	35688682	missense	probably null	1.00
R2873:Slit3	UTSW	11	35544793	nonsense	probably null
R3813:Slit3	UTSW	11	35675979	missense	probably damaging	1.00
R3831:Slit3	UTSW	11	35688682	missense	probably null	1.00
R3832:Slit3	UTSW	11	35688682	missense	probably null	1.00
R3833:Slit3	UTSW	11	35688682	missense	probably null	1.00
R3839:Slit3	UTSW	11	35508237	missense	probably benign	0.10
R4152:Slit3	UTSW	11	35698320	missense	probably damaging	0.98
R4387:Slit3	UTSW	11	35684048	missense	probably benign	0.12
R4795:Slit3	UTSW	11	35651820	critical splice donor site	probably null
R4910:Slit3	UTSW	11	35632722	missense	probably damaging	0.99
R5048:Slit3	UTSW	11	35588985	missense	probably damaging	1.00
R5106:Slit3	UTSW	11	35612367	missense	probably damaging	1.00
R5138:Slit3	UTSW	11	35588985	missense	probably damaging	1.00
R5218:Slit3	UTSW	11	35684175	critical splice donor site	probably null
R5338:Slit3	UTSW	11	35622148	missense	probably benign
R5354:Slit3	UTSW	11	35675913	missense	probably damaging	1.00
R5436:Slit3	UTSW	11	35707911	missense	probably benign	0.05
R5896:Slit3	UTSW	11	35708105	missense	probably damaging	0.99
R5933:Slit3	UTSW	11	35629751	missense	probably benign	0.04
R5963:Slit3	UTSW	11	35700236	missense	probably damaging	1.00
R5964:Slit3	UTSW	11	35700236	missense	probably damaging	1.00
R6125:Slit3	UTSW	11	35570733	critical splice donor site	probably null
R6153:Slit3	UTSW	11	35700483	missense	possibly damaging	0.69
R6484:Slit3	UTSW	11	35661298	missense	probably benign
R6526:Slit3	UTSW	11	35661292	missense	probably benign	0.33
R6797:Slit3	UTSW	11	35633952	missense	possibly damaging	0.55
R6887:Slit3	UTSW	11	35544806	splice site	probably null
R7067:Slit3	UTSW	11	35508230	missense	probably benign	0.04
R7150:Slit3	UTSW	11	35570719	missense	probably damaging	1.00
R7228:Slit3	UTSW	11	35599418	missense	probably damaging	1.00
R7232:Slit3	UTSW	11	35610689	missense	possibly damaging	0.87
R7418:Slit3	UTSW	11	35686428	missense	possibly damaging	0.64
R7545:Slit3	UTSW	11	35700312	missense	possibly damaging	0.52
R7727:Slit3	UTSW	11	35684044	missense	probably damaging	1.00
R7820:Slit3	UTSW	11	35700408	missense	probably benign	0.23
R8177:Slit3	UTSW	11	35579092	missense	probably damaging	0.99
R8179:Slit3	UTSW	11	35664076	missense	probably benign	0.31
R8416:Slit3	UTSW	11	35508235	missense	probably benign	0.08
R8417:Slit3	UTSW	11	35610611	missense	probably damaging	0.99
R8476:Slit3	UTSW	11	35629769	missense	possibly damaging	0.70
R8785:Slit3	UTSW	11	35670141	missense	probably damaging	0.98
R8955:Slit3	UTSW	11	35698380	missense	probably damaging	0.97
R9040:Slit3	UTSW	11	35703309	missense	probably damaging	0.98
R9068:Slit3	UTSW	11	35684090	missense	probably damaging	1.00
R9088:Slit3	UTSW	11	35121636	missense	possibly damaging	0.86
R9266:Slit3	UTSW	11	35707981	missense	probably damaging	0.98
R9539:Slit3	UTSW	11	35698328	nonsense	probably null
R9636:Slit3	UTSW	11	35703261	missense	probably damaging	0.97
X0028:Slit3	UTSW	11	35564637	missense	probably damaging	0.99
Z1176:Slit3	UTSW	11	35707924	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GACTTGAGACTTGCCTTCTGC -3'
(R):5'- CACTGTGTGAGAGCTGTGTC -3'

Sequencing Primer
(F):5'- TTCTGCACTTGAAAGGCCAG -3'
(R):5'- AGAGCTGTGTCTGTGTGGGAC -3'

Posted On

2016-04-15