Incidental Mutation 'R4933:Mapk7'
ID 380730
Institutional Source Beutler Lab
Gene Symbol Mapk7
Ensembl Gene ENSMUSG00000001034
Gene Name mitogen-activated protein kinase 7
Synonyms big MAP kinase 1, Erk5-T, BMK1, ERK5
MMRRC Submission 042533-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4933 (G1)
Quality Score 155
Status Validated
Chromosome 11
Chromosomal Location 61488812-61494406 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) G to T at 61493908 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079080] [ENSMUST00000101085] [ENSMUST00000108714] [ENSMUST00000153441]
AlphaFold Q9WVS8
Predicted Effect probably benign
Transcript: ENSMUST00000079080
SMART Domains Protein: ENSMUSP00000078087
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
S_TKc 55 347 5.66e-96 SMART
low complexity region 433 447 N/A INTRINSIC
low complexity region 476 492 N/A INTRINSIC
coiled coil region 508 544 N/A INTRINSIC
low complexity region 578 603 N/A INTRINSIC
low complexity region 620 644 N/A INTRINSIC
low complexity region 675 692 N/A INTRINSIC
low complexity region 758 772 N/A INTRINSIC
low complexity region 791 803 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101085
SMART Domains Protein: ENSMUSP00000098646
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
S_TKc 4 277 3.48e-73 SMART
low complexity region 363 377 N/A INTRINSIC
coiled coil region 405 441 N/A INTRINSIC
low complexity region 475 500 N/A INTRINSIC
low complexity region 517 541 N/A INTRINSIC
low complexity region 572 589 N/A INTRINSIC
low complexity region 655 669 N/A INTRINSIC
low complexity region 688 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108714
SMART Domains Protein: ENSMUSP00000104354
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
S_TKc 1 278 1.76e-74 SMART
low complexity region 364 378 N/A INTRINSIC
low complexity region 407 423 N/A INTRINSIC
coiled coil region 439 475 N/A INTRINSIC
low complexity region 509 534 N/A INTRINSIC
low complexity region 551 575 N/A INTRINSIC
low complexity region 606 623 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152755
Predicted Effect probably benign
Transcript: ENSMUST00000153441
SMART Domains Protein: ENSMUSP00000116084
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
PDB:4IC8|B 1 49 2e-26 PDB
low complexity region 51 65 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
coiled coil region 126 162 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is specifically activated by mitogen-activated protein kinase kinase 5 (MAP2K5/MEK5). It is involved in the downstream signaling processes of various receptor molecules including receptor type kinases, and G protein-coupled receptors. In response to extracelluar signals, this kinase translocates to cell nucleus, where it regulates gene expression by phosphorylating, and activating different transcription factors. Four alternatively spliced transcript variants of this gene encoding two distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to embryonic growth retardation and midgestational lethality due to multiple developmental anomalies and vascular remodelling, cardiac development, and placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,802 E643G probably damaging Het
4430402I18Rik G T 19: 28,941,775 H195N possibly damaging Het
Abca2 T C 2: 25,444,827 V1937A probably benign Het
Acot10 A T 15: 20,666,330 N108K possibly damaging Het
Agtpbp1 A T 13: 59,500,572 M478K probably benign Het
Akirin1 G A 4: 123,736,858 S191F probably damaging Het
Aurkb T C 11: 69,048,144 probably benign Het
Cabyr T C 18: 12,744,492 probably benign Het
Ccp110 A G 7: 118,725,319 E688G probably damaging Het
Champ1 T A 8: 13,879,137 S432T probably benign Het
Crybg1 T A 10: 43,999,213 N633I probably damaging Het
Dagla A T 19: 10,269,715 probably null Het
Dkkl1 A T 7: 45,211,525 L10Q probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
E430018J23Rik A G 7: 127,393,349 Y30H probably damaging Het
Fndc7 G T 3: 108,876,670 Q208K probably benign Het
Gins4 A T 8: 23,234,780 C53S probably damaging Het
Gja8 T A 3: 96,919,035 probably benign Het
Golph3l T A 3: 95,617,423 N328K probably benign Het
Haus6 A C 4: 86,585,287 probably benign Het
Hdac5 A G 11: 102,200,563 probably benign Het
Ide A G 19: 37,277,756 Y883H unknown Het
Igf2r A G 17: 12,691,877 probably null Het
Kdm3b T C 18: 34,810,393 Y723H probably damaging Het
Kif21b G A 1: 136,151,325 probably null Het
Lancl1 A T 1: 67,021,034 N77K probably benign Het
Lyst T A 13: 13,637,764 N920K probably damaging Het
Lyst G A 13: 13,759,378 V3554I probably benign Het
Map1a G A 2: 121,305,905 A2163T probably damaging Het
Myo10 C A 15: 25,781,118 Q154K probably damaging Het
Olfr13 C T 6: 43,174,321 L112F probably benign Het
Olfr132 A G 17: 38,130,550 I214T probably damaging Het
Pcdhgb2 G A 18: 37,692,214 V753M probably benign Het
Pnn T A 12: 59,070,227 L195Q probably damaging Het
Pot1a A G 6: 25,771,541 V227A possibly damaging Het
Ppp1r21 T A 17: 88,547,621 D109E probably benign Het
Prr15l G A 11: 96,934,762 G73S probably damaging Het
Rnf148 A G 6: 23,654,340 F219S probably benign Het
Rnpep C A 1: 135,267,026 probably benign Het
Ryr1 T C 7: 29,104,298 T643A probably damaging Het
Ryr2 A T 13: 11,945,945 C36S probably damaging Het
Shc3 G T 13: 51,442,769 T406N probably benign Het
Slit3 G T 11: 35,688,593 G1199V probably damaging Het
Sptbn5 G A 2: 120,050,120 noncoding transcript Het
St8sia6 T C 2: 13,665,442 N236D probably damaging Het
Stpg1 A T 4: 135,506,416 Q3L probably benign Het
Sult3a1 T A 10: 33,866,554 I59N probably damaging Het
Svs1 T C 6: 48,987,492 S145P probably damaging Het
Vmn1r208 T G 13: 22,772,788 I180L probably benign Het
Vmn2r51 A T 7: 10,098,320 N446K probably damaging Het
Vmn2r63 A T 7: 42,903,978 I618N probably damaging Het
Wrn T C 8: 33,322,343 N182S probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zmynd8 A G 2: 165,834,951 V249A possibly damaging Het
Zswim2 A G 2: 83,925,227 L110P probably damaging Het
Other mutations in Mapk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Mapk7 APN 11 61491160 missense probably damaging 1.00
IGL02289:Mapk7 APN 11 61489959 splice site probably null
IGL03108:Mapk7 APN 11 61491672 missense probably damaging 1.00
IGL03342:Mapk7 APN 11 61491390 missense probably damaging 1.00
FR4340:Mapk7 UTSW 11 61490206 intron probably benign
FR4589:Mapk7 UTSW 11 61490222 intron probably benign
R1497:Mapk7 UTSW 11 61493863 missense possibly damaging 0.53
R1866:Mapk7 UTSW 11 61489413 missense probably benign 0.27
R2870:Mapk7 UTSW 11 61490212 intron probably benign
R2871:Mapk7 UTSW 11 61490212 intron probably benign
R2872:Mapk7 UTSW 11 61490212 intron probably benign
R3831:Mapk7 UTSW 11 61489854 missense possibly damaging 0.83
R3832:Mapk7 UTSW 11 61489854 missense possibly damaging 0.83
R3833:Mapk7 UTSW 11 61489854 missense possibly damaging 0.83
R4378:Mapk7 UTSW 11 61493667 missense probably damaging 1.00
R4428:Mapk7 UTSW 11 61489229 missense possibly damaging 0.90
R4642:Mapk7 UTSW 11 61490901 missense probably damaging 0.99
R4692:Mapk7 UTSW 11 61489242 missense possibly damaging 0.73
R4718:Mapk7 UTSW 11 61489254 missense possibly damaging 0.73
R4755:Mapk7 UTSW 11 61490843 missense probably damaging 1.00
R4916:Mapk7 UTSW 11 61493649 missense probably damaging 0.97
R5825:Mapk7 UTSW 11 61490381 missense possibly damaging 0.66
R5875:Mapk7 UTSW 11 61493698 missense probably benign 0.13
R5910:Mapk7 UTSW 11 61493621 start codon destroyed probably benign 0.01
R7201:Mapk7 UTSW 11 61489172 missense probably benign 0.33
R7465:Mapk7 UTSW 11 61490453 missense probably damaging 1.00
R7797:Mapk7 UTSW 11 61489415 missense possibly damaging 0.72
R8867:Mapk7 UTSW 11 61493806 missense probably benign 0.41
R8953:Mapk7 UTSW 11 61492966 missense possibly damaging 0.81
R9243:Mapk7 UTSW 11 61493709 missense possibly damaging 0.94
R9394:Mapk7 UTSW 11 61491032 missense probably damaging 1.00
RF031:Mapk7 UTSW 11 61490234 intron probably benign
Z1177:Mapk7 UTSW 11 61491362 missense probably damaging 1.00
Z1186:Mapk7 UTSW 11 61490212 intron probably benign
Z1186:Mapk7 UTSW 11 61490216 intron probably benign
Z1186:Mapk7 UTSW 11 61490227 intron probably benign
Z1187:Mapk7 UTSW 11 61490212 intron probably benign
Z1187:Mapk7 UTSW 11 61490227 intron probably benign
Z1188:Mapk7 UTSW 11 61490212 intron probably benign
Z1188:Mapk7 UTSW 11 61490227 intron probably benign
Z1188:Mapk7 UTSW 11 61490244 intron probably benign
Z1189:Mapk7 UTSW 11 61490227 intron probably benign
Z1190:Mapk7 UTSW 11 61490227 intron probably benign
Z1191:Mapk7 UTSW 11 61490212 intron probably benign
Z1191:Mapk7 UTSW 11 61490227 intron probably benign
Z1192:Mapk7 UTSW 11 61490227 intron probably benign
Predicted Primers PCR Primer
(F):5'- GTCAAAGGTCACGTCGAAGG -3'
(R):5'- TTGGCAAGACTCAGGAATCC -3'

Sequencing Primer
(F):5'- TCACGTCGAAGGAGCGG -3'
(R):5'- TCCCAAATTCCCGAGGAGG -3'
Posted On 2016-04-15