Incidental Mutation 'R0399:Mmp28'
ID38074
Institutional Source Beutler Lab
Gene Symbol Mmp28
Ensembl Gene ENSMUSG00000020682
Gene Namematrix metallopeptidase 28 (epilysin)
Synonymsepilysin
MMRRC Submission 038604-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R0399 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location83440768-83463071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83451732 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 40 (L40Q)
Ref Sequence ENSEMBL: ENSMUSP00000112566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021020] [ENSMUST00000103209] [ENSMUST00000108137] [ENSMUST00000119346]
Predicted Effect probably damaging
Transcript: ENSMUST00000021020
AA Change: L40Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021020
Gene: ENSMUSG00000020682
AA Change: L40Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PG_binding_1 31 86 1e-11 PFAM
low complexity region 114 125 N/A INTRINSIC
ZnMc 126 285 3.92e-39 SMART
HX 328 361 7.46e0 SMART
HX 363 406 1.64e-1 SMART
HX 408 454 1.78e-2 SMART
HX 456 500 5.79e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103209
AA Change: L40Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099498
Gene: ENSMUSG00000020682
AA Change: L40Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PG_binding_1 31 86 9.7e-12 PFAM
low complexity region 114 125 N/A INTRINSIC
ZnMc 126 285 3.92e-39 SMART
HX 349 392 1.64e-1 SMART
HX 394 440 1.78e-2 SMART
HX 442 486 5.79e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108137
AA Change: L40Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103772
Gene: ENSMUSG00000020682
AA Change: L40Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PG_binding_1 31 86 2.6e-11 PFAM
low complexity region 114 125 N/A INTRINSIC
ZnMc 126 285 3.92e-39 SMART
HX 328 371 2.72e-7 SMART
HX 373 416 1.64e-1 SMART
HX 418 464 1.78e-2 SMART
HX 466 510 5.79e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119346
AA Change: L40Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112566
Gene: ENSMUSG00000020682
AA Change: L40Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PG_binding_1 31 86 7.4e-12 PFAM
low complexity region 114 125 N/A INTRINSIC
ZnMc 126 285 3.92e-39 SMART
HX 328 371 2.72e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138780
Meta Mutation Damage Score 0.4285 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix for both normal physiological processes, such as embryonic development, reproduction and tissue remodeling, and disease processes, such as asthma and metastasis. This gene encodes a secreted enzyme that degrades casein. Its expression pattern suggests that it plays a role in tissue homeostasis and in wound repair. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Null homozygote mice have enhanced chemotaxis of macrophages into the lung upon infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,750,959 probably benign Het
6030452D12Rik T C 8: 106,504,542 M120T unknown Het
Actr1a A T 19: 46,385,011 probably null Het
AI314180 T C 4: 58,827,047 T1029A possibly damaging Het
Anapc5 A T 5: 122,791,753 V555D probably damaging Het
Aox1 A G 1: 58,068,849 probably null Het
Arhgap30 A G 1: 171,404,816 E343G probably damaging Het
Asap2 C T 12: 21,217,997 T291I possibly damaging Het
Atp5a1 T A 18: 77,781,836 Y439* probably null Het
Auts2 A T 5: 131,440,524 S428T probably benign Het
B3gnt7 T A 1: 86,305,711 C109* probably null Het
C4b C A 17: 34,728,869 Q1657H probably damaging Het
Cadm2 A T 16: 66,747,339 L268* probably null Het
Cep290 G A 10: 100,554,400 probably benign Het
Cep68 T G 11: 20,230,571 I687L probably benign Het
Chd6 T A 2: 161,052,688 D84V probably damaging Het
Clpx A G 9: 65,322,769 T514A probably benign Het
Cox18 A T 5: 90,215,028 C324S probably benign Het
Cryzl2 T C 1: 157,462,016 Y75H probably damaging Het
Cxcr6 C T 9: 123,810,951 A339V possibly damaging Het
Dock1 T C 7: 135,163,442 L1721P probably benign Het
Dstyk T C 1: 132,453,080 probably benign Het
Ehf A G 2: 103,266,870 Y246H probably damaging Het
Epas1 T C 17: 86,805,193 V73A probably benign Het
Filip1 A G 9: 79,818,310 I1009T possibly damaging Het
Glis3 A T 19: 28,298,768 probably benign Het
Gm17333 A T 16: 77,852,790 noncoding transcript Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Gpr155 A T 2: 73,370,002 I387N possibly damaging Het
Gria1 A G 11: 57,186,027 D83G probably damaging Het
Grid2 A G 6: 64,666,052 I933V probably benign Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Hook2 A G 8: 84,993,567 probably benign Het
Ift140 T A 17: 25,050,340 S656R possibly damaging Het
Il11ra1 A T 4: 41,766,185 T241S probably benign Het
Kank1 A G 19: 25,411,242 I760V probably benign Het
Kansl1 T C 11: 104,424,132 E360G possibly damaging Het
Klf9 A T 19: 23,142,082 S110C probably damaging Het
Klhl31 A G 9: 77,650,653 N217S probably benign Het
Lct T C 1: 128,300,525 Y1077C probably damaging Het
Lrrc49 A T 9: 60,610,246 probably benign Het
Lrrn1 T A 6: 107,569,120 H626Q probably benign Het
Mroh1 C T 15: 76,452,099 A1530V probably benign Het
Myo1e A G 9: 70,301,793 probably benign Het
Naa25 A T 5: 121,435,490 M761L probably benign Het
Ncln G A 10: 81,488,297 A465V probably damaging Het
Nktr A G 9: 121,731,484 N98S probably damaging Het
Olfr1012 T C 2: 85,759,904 I157M possibly damaging Het
Olfr215 C A 6: 116,582,781 S55I probably benign Het
Olfr651 T A 7: 104,553,369 V150E probably benign Het
Olfr76 G C 19: 12,120,370 A114G possibly damaging Het
Olfr878 G T 9: 37,919,553 A304S possibly damaging Het
Pacsin2 T C 15: 83,386,782 Y222C probably damaging Het
Pcdhb15 C T 18: 37,474,168 T151M possibly damaging Het
Plcz1 C A 6: 140,023,230 V161L possibly damaging Het
Ppp6c G A 2: 39,200,124 probably benign Het
Rhbdf2 T A 11: 116,603,992 Y286F probably benign Het
Rtn3 A T 19: 7,457,876 D231E probably damaging Het
Slc35c2 A C 2: 165,280,895 Y156* probably null Het
Spata46 A G 1: 170,311,537 D35G probably damaging Het
Tmed3 A G 9: 89,702,873 F110L possibly damaging Het
Tmem104 T G 11: 115,201,308 probably benign Het
Tpbg T A 9: 85,844,938 V320E possibly damaging Het
Trib2 T C 12: 15,793,663 D190G probably damaging Het
Tspan2 A G 3: 102,759,385 T26A probably damaging Het
Usp17lb A C 7: 104,841,151 Y190D possibly damaging Het
Utp18 C T 11: 93,880,147 probably benign Het
Utp20 A T 10: 88,820,979 D121E probably damaging Het
Vmn1r80 T A 7: 12,193,317 M118K possibly damaging Het
Vmn1r84 T C 7: 12,361,867 S300G probably benign Het
Other mutations in Mmp28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Mmp28 APN 11 83443776 missense possibly damaging 0.93
IGL02559:Mmp28 APN 11 83447740 missense probably benign 0.00
R0492:Mmp28 UTSW 11 83443803 missense probably damaging 1.00
R1432:Mmp28 UTSW 11 83442939 missense probably damaging 1.00
R1822:Mmp28 UTSW 11 83444219 missense probably damaging 0.99
R2181:Mmp28 UTSW 11 83442717 missense possibly damaging 0.92
R5346:Mmp28 UTSW 11 83442663 missense probably benign
R5532:Mmp28 UTSW 11 83442858 missense probably damaging 1.00
R5548:Mmp28 UTSW 11 83443907 nonsense probably null
R7580:Mmp28 UTSW 11 83444832 missense probably damaging 0.98
R7882:Mmp28 UTSW 11 83443926 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACTGGAACTCTCTGCCAGAAG -3'
(R):5'- GCCGGATTATACGAAGGCTGGATG -3'

Sequencing Primer
(F):5'- CTCTCTGCCAGAAGGAAGTG -3'
(R):5'- ATCTAGTCGATGATGGCCTTC -3'
Posted On2013-05-23