Incidental Mutation 'R4933:Myo10'
ID 380741
Institutional Source Beutler Lab
Gene Symbol Myo10
Ensembl Gene ENSMUSG00000022272
Gene Name myosin X
Synonyms D15Ertd600e, myosin-X
MMRRC Submission 042533-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4933 (G1)
Quality Score 206
Status Validated
Chromosome 15
Chromosomal Location 25622525-25813673 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 25781118 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 154 (Q154K)
Ref Sequence ENSEMBL: ENSMUSP00000022882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022882] [ENSMUST00000110457] [ENSMUST00000124966] [ENSMUST00000125667] [ENSMUST00000135173] [ENSMUST00000137601] [ENSMUST00000151360]
AlphaFold F8VQB6
Predicted Effect probably damaging
Transcript: ENSMUST00000022882
AA Change: Q154K

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022882
Gene: ENSMUSG00000022272
AA Change: Q154K

DomainStartEndE-ValueType
IQ 1 17 7.83e1 SMART
IQ 18 40 1.06e0 SMART
IQ 41 63 7.07e-2 SMART
PDB:2LW9|B 136 171 7e-13 PDB
low complexity region 172 186 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 344 356 N/A INTRINSIC
low complexity region 401 419 N/A INTRINSIC
PH 471 570 1.39e-21 SMART
SCOP:d1faoa_ 588 639 3e-6 SMART
PH 651 757 6.76e-11 SMART
MyTH4 805 953 4.12e-37 SMART
B41 954 1216 1.72e-44 SMART
Blast:B41 1218 1303 3e-45 BLAST
low complexity region 1304 1316 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110457
AA Change: Q900K

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106087
Gene: ENSMUSG00000022272
AA Change: Q900K

DomainStartEndE-ValueType
MYSc 57 740 N/A SMART
IQ 741 763 1.27e-3 SMART
IQ 764 786 1.06e0 SMART
IQ 787 809 7.07e-2 SMART
Pfam:MYO10_CC 881 932 4.2e-22 PFAM
low complexity region 959 981 N/A INTRINSIC
low complexity region 1090 1102 N/A INTRINSIC
low complexity region 1147 1165 N/A INTRINSIC
PH 1217 1316 1.39e-21 SMART
PH 1397 1503 6.76e-11 SMART
MyTH4 1551 1699 4.12e-37 SMART
B41 1700 1962 1.72e-44 SMART
low complexity region 2050 2062 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124966
SMART Domains Protein: ENSMUSP00000120817
Gene: ENSMUSG00000022272

DomainStartEndE-ValueType
IQ 1 17 7.83e1 SMART
IQ 18 40 1.06e0 SMART
IQ 41 63 7.07e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125667
SMART Domains Protein: ENSMUSP00000120566
Gene: ENSMUSG00000022272

DomainStartEndE-ValueType
Pfam:Myosin_head 1 85 5.8e-22 PFAM
IQ 99 121 1.27e-3 SMART
IQ 122 144 1.06e0 SMART
IQ 145 167 7.07e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135173
SMART Domains Protein: ENSMUSP00000118744
Gene: ENSMUSG00000022272

DomainStartEndE-ValueType
Pfam:Myosin_head 1 84 1.4e-21 PFAM
IQ 98 120 1.27e-3 SMART
IQ 121 143 1.06e0 SMART
IQ 144 166 7.07e-2 SMART
low complexity region 168 179 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000135981
AA Change: Q217K
SMART Domains Protein: ENSMUSP00000123057
Gene: ENSMUSG00000022272
AA Change: Q217K

DomainStartEndE-ValueType
PDB:2DFS|M 2 38 6e-7 PDB
Blast:MYSc 2 42 3e-19 BLAST
IQ 59 81 1.27e-3 SMART
IQ 82 104 1.06e0 SMART
IQ 105 127 7.07e-2 SMART
Pfam:MYO10_CC 199 242 1.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137601
SMART Domains Protein: ENSMUSP00000118280
Gene: ENSMUSG00000022272

DomainStartEndE-ValueType
MYSc 24 707 N/A SMART
IQ 708 730 1.27e-3 SMART
IQ 731 753 1.06e0 SMART
IQ 754 776 7.07e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145587
Predicted Effect probably benign
Transcript: ENSMUST00000151360
SMART Domains Protein: ENSMUSP00000119367
Gene: ENSMUSG00000022272

DomainStartEndE-ValueType
Pfam:Myosin_head 1 51 7.1e-16 PFAM
Meta Mutation Damage Score 0.0850 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-10 (MYH10). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. This gene functions as an actin-based molecular motor and plays a role in integration of F-actin and microtubule cytoskeletons during meiosis. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutations are semi-lethal with over half of homozygous embryos exhibiting exencephaly. Surviving mutants show decreased body weight, white spotting, syndactyly, persistence of hyaloid vascular system and other eye defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,802 E643G probably damaging Het
4430402I18Rik G T 19: 28,941,775 H195N possibly damaging Het
Abca2 T C 2: 25,444,827 V1937A probably benign Het
Acot10 A T 15: 20,666,330 N108K possibly damaging Het
Agtpbp1 A T 13: 59,500,572 M478K probably benign Het
Akirin1 G A 4: 123,736,858 S191F probably damaging Het
Aurkb T C 11: 69,048,144 probably benign Het
Cabyr T C 18: 12,744,492 probably benign Het
Ccp110 A G 7: 118,725,319 E688G probably damaging Het
Champ1 T A 8: 13,879,137 S432T probably benign Het
Crybg1 T A 10: 43,999,213 N633I probably damaging Het
Dagla A T 19: 10,269,715 probably null Het
Dkkl1 A T 7: 45,211,525 L10Q probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
E430018J23Rik A G 7: 127,393,349 Y30H probably damaging Het
Fndc7 G T 3: 108,876,670 Q208K probably benign Het
Gins4 A T 8: 23,234,780 C53S probably damaging Het
Gja8 T A 3: 96,919,035 probably benign Het
Golph3l T A 3: 95,617,423 N328K probably benign Het
Haus6 A C 4: 86,585,287 probably benign Het
Hdac5 A G 11: 102,200,563 probably benign Het
Ide A G 19: 37,277,756 Y883H unknown Het
Igf2r A G 17: 12,691,877 probably null Het
Kdm3b T C 18: 34,810,393 Y723H probably damaging Het
Kif21b G A 1: 136,151,325 probably null Het
Lancl1 A T 1: 67,021,034 N77K probably benign Het
Lyst T A 13: 13,637,764 N920K probably damaging Het
Lyst G A 13: 13,759,378 V3554I probably benign Het
Map1a G A 2: 121,305,905 A2163T probably damaging Het
Mapk7 G T 11: 61,493,908 probably benign Het
Olfr13 C T 6: 43,174,321 L112F probably benign Het
Olfr132 A G 17: 38,130,550 I214T probably damaging Het
Pcdhgb2 G A 18: 37,692,214 V753M probably benign Het
Pnn T A 12: 59,070,227 L195Q probably damaging Het
Pot1a A G 6: 25,771,541 V227A possibly damaging Het
Ppp1r21 T A 17: 88,547,621 D109E probably benign Het
Prr15l G A 11: 96,934,762 G73S probably damaging Het
Rnf148 A G 6: 23,654,340 F219S probably benign Het
Rnpep C A 1: 135,267,026 probably benign Het
Ryr1 T C 7: 29,104,298 T643A probably damaging Het
Ryr2 A T 13: 11,945,945 C36S probably damaging Het
Shc3 G T 13: 51,442,769 T406N probably benign Het
Slit3 G T 11: 35,688,593 G1199V probably damaging Het
Sptbn5 G A 2: 120,050,120 noncoding transcript Het
St8sia6 T C 2: 13,665,442 N236D probably damaging Het
Stpg1 A T 4: 135,506,416 Q3L probably benign Het
Sult3a1 T A 10: 33,866,554 I59N probably damaging Het
Svs1 T C 6: 48,987,492 S145P probably damaging Het
Vmn1r208 T G 13: 22,772,788 I180L probably benign Het
Vmn2r51 A T 7: 10,098,320 N446K probably damaging Het
Vmn2r63 A T 7: 42,903,978 I618N probably damaging Het
Wrn T C 8: 33,322,343 N182S probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zmynd8 A G 2: 165,834,951 V249A possibly damaging Het
Zswim2 A G 2: 83,925,227 L110P probably damaging Het
Other mutations in Myo10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Myo10 APN 15 25776380 missense probably damaging 1.00
IGL01068:Myo10 APN 15 25739309 missense possibly damaging 0.93
IGL01352:Myo10 APN 15 25701697 missense probably damaging 1.00
IGL01388:Myo10 APN 15 25736617 missense possibly damaging 0.55
IGL01460:Myo10 APN 15 25714108 missense probably benign 0.00
IGL01553:Myo10 APN 15 25776329 missense probably damaging 1.00
IGL01732:Myo10 APN 15 25732063 missense probably benign 0.10
IGL01992:Myo10 APN 15 25799548 missense possibly damaging 0.92
IGL02000:Myo10 APN 15 25808066 missense probably damaging 1.00
IGL02045:Myo10 APN 15 25726488 missense probably benign 0.03
IGL02307:Myo10 APN 15 25776315 splice site probably benign
IGL02511:Myo10 APN 15 25723889 missense probably damaging 0.97
IGL03240:Myo10 APN 15 25701602 missense probably damaging 1.00
least UTSW 15 25726475 nonsense probably null
R0037:Myo10 UTSW 15 25666532 intron probably benign
R0153:Myo10 UTSW 15 25781238 missense possibly damaging 0.84
R0282:Myo10 UTSW 15 25793167 missense probably damaging 1.00
R0360:Myo10 UTSW 15 25804368 missense probably damaging 1.00
R0585:Myo10 UTSW 15 25736455 missense probably damaging 1.00
R0617:Myo10 UTSW 15 25738005 missense probably damaging 1.00
R0729:Myo10 UTSW 15 25722157 splice site probably benign
R0771:Myo10 UTSW 15 25778178 missense probably damaging 1.00
R0960:Myo10 UTSW 15 25801189 missense probably damaging 1.00
R1562:Myo10 UTSW 15 25780411 missense possibly damaging 0.81
R1651:Myo10 UTSW 15 25742369 missense probably damaging 1.00
R1789:Myo10 UTSW 15 25726525 critical splice donor site probably null
R1816:Myo10 UTSW 15 25800200 missense probably damaging 1.00
R1835:Myo10 UTSW 15 25805587 missense possibly damaging 0.53
R1908:Myo10 UTSW 15 25801222 missense probably damaging 1.00
R2082:Myo10 UTSW 15 25785993 missense probably damaging 1.00
R2101:Myo10 UTSW 15 25722259 missense probably benign 0.26
R2129:Myo10 UTSW 15 25781799 missense probably benign 0.09
R2141:Myo10 UTSW 15 25714108 missense probably benign
R2142:Myo10 UTSW 15 25714108 missense probably benign
R2920:Myo10 UTSW 15 25801140 missense probably damaging 1.00
R2938:Myo10 UTSW 15 25795717 missense probably damaging 0.99
R3723:Myo10 UTSW 15 25803288 missense probably damaging 1.00
R3852:Myo10 UTSW 15 25779626 missense probably damaging 1.00
R4162:Myo10 UTSW 15 25726415 splice site probably null
R4163:Myo10 UTSW 15 25726415 splice site probably null
R4164:Myo10 UTSW 15 25726415 splice site probably null
R4177:Myo10 UTSW 15 25734051 missense possibly damaging 0.81
R4409:Myo10 UTSW 15 25807869 missense probably damaging 1.00
R4667:Myo10 UTSW 15 25793153 missense possibly damaging 0.91
R4905:Myo10 UTSW 15 25800212 missense probably damaging 0.99
R4968:Myo10 UTSW 15 25808184 missense probably damaging 1.00
R5081:Myo10 UTSW 15 25785940 missense probably damaging 1.00
R5123:Myo10 UTSW 15 25726483 missense possibly damaging 0.94
R5310:Myo10 UTSW 15 25778078 splice site probably null
R6073:Myo10 UTSW 15 25736642 missense probably damaging 1.00
R6117:Myo10 UTSW 15 25805659 missense probably benign 0.00
R6185:Myo10 UTSW 15 25726510 missense probably damaging 0.99
R6749:Myo10 UTSW 15 25714110 missense probably damaging 1.00
R6819:Myo10 UTSW 15 25781410 missense possibly damaging 0.80
R6875:Myo10 UTSW 15 25805659 missense probably benign 0.00
R6908:Myo10 UTSW 15 25804383 missense probably damaging 1.00
R6963:Myo10 UTSW 15 25734063 missense probably benign 0.31
R7144:Myo10 UTSW 15 25723925 missense probably damaging 1.00
R7266:Myo10 UTSW 15 25782981 missense probably damaging 1.00
R7380:Myo10 UTSW 15 25779620 missense probably benign 0.01
R7460:Myo10 UTSW 15 25807827 missense probably damaging 1.00
R7614:Myo10 UTSW 15 25701623 missense probably benign 0.00
R7618:Myo10 UTSW 15 25726475 nonsense probably null
R7717:Myo10 UTSW 15 25731970 missense probably benign 0.01
R7811:Myo10 UTSW 15 25804524 missense probably damaging 1.00
R7830:Myo10 UTSW 15 25737971 nonsense probably null
R7862:Myo10 UTSW 15 25666436 missense probably damaging 1.00
R8232:Myo10 UTSW 15 25804314 missense possibly damaging 0.89
R8264:Myo10 UTSW 15 25800109 missense probably damaging 0.99
R8377:Myo10 UTSW 15 25804395 missense possibly damaging 0.94
R8385:Myo10 UTSW 15 25804398 missense probably damaging 1.00
R8426:Myo10 UTSW 15 25799490 missense probably damaging 0.99
R8439:Myo10 UTSW 15 25725072 missense probably benign 0.00
R8696:Myo10 UTSW 15 25799486 missense probably damaging 1.00
R8775:Myo10 UTSW 15 25800059 missense probably damaging 0.97
R8775-TAIL:Myo10 UTSW 15 25800059 missense probably damaging 0.97
R8970:Myo10 UTSW 15 25803381 missense possibly damaging 0.82
R9024:Myo10 UTSW 15 25793209 missense possibly damaging 0.53
R9196:Myo10 UTSW 15 25805630 missense probably damaging 0.96
R9224:Myo10 UTSW 15 25807995 missense probably benign 0.33
R9308:Myo10 UTSW 15 25781776 missense probably damaging 0.99
R9358:Myo10 UTSW 15 25781434 missense possibly damaging 0.69
R9606:Myo10 UTSW 15 25776315 frame shift probably null
R9722:Myo10 UTSW 15 25801141 missense probably damaging 1.00
RF013:Myo10 UTSW 15 25799479 missense probably damaging 0.99
Z1177:Myo10 UTSW 15 25781401 missense probably damaging 1.00
Z1177:Myo10 UTSW 15 25799554 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAAGGTGCTTGTTCTAAAACCCAC -3'
(R):5'- TGAGCTCTTCGCCCGAAATC -3'

Sequencing Primer
(F):5'- GCTTGTTCTAAAACCCACCTTGC -3'
(R):5'- ACAGGGAGCGCTCGATGTTG -3'
Posted On 2016-04-15