Incidental Mutation 'R4933:Kdm3b'
ID 380748
Institutional Source Beutler Lab
Gene Symbol Kdm3b
Ensembl Gene ENSMUSG00000038773
Gene Name KDM3B lysine (K)-specific demethylase 3B
Synonyms Jmjd1b, 5830462I21Rik, JHDM2B
MMRRC Submission 042533-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.943) question?
Stock # R4933 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 34910100-34971713 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34943446 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 723 (Y723H)
Ref Sequence ENSEMBL: ENSMUSP00000153446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043775] [ENSMUST00000225195]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000043775
AA Change: Y923H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037628
Gene: ENSMUSG00000038773
AA Change: Y923H

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
Blast:JmjC 149 944 N/A BLAST
Blast:JmjC 946 1064 5e-40 BLAST
Blast:JmjC 1069 1471 N/A BLAST
JmjC 1499 1722 2.43e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224065
Predicted Effect probably damaging
Transcript: ENSMUST00000225195
AA Change: Y723H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.1245 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 97% (73/75)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,276,226 (GRCm39) E643G probably damaging Het
Abca2 T C 2: 25,334,839 (GRCm39) V1937A probably benign Het
Acot10 A T 15: 20,666,416 (GRCm39) N108K possibly damaging Het
Agtpbp1 A T 13: 59,648,386 (GRCm39) M478K probably benign Het
Akirin1 G A 4: 123,630,651 (GRCm39) S191F probably damaging Het
Aoc1l3 T C 6: 48,964,426 (GRCm39) S145P probably damaging Het
Aurkb T C 11: 68,938,970 (GRCm39) probably benign Het
Cabyr T C 18: 12,877,549 (GRCm39) probably benign Het
Ccp110 A G 7: 118,324,542 (GRCm39) E688G probably damaging Het
Champ1 T A 8: 13,929,137 (GRCm39) S432T probably benign Het
Crybg1 T A 10: 43,875,209 (GRCm39) N633I probably damaging Het
Dagla A T 19: 10,247,079 (GRCm39) probably null Het
Dkkl1 A T 7: 44,860,949 (GRCm39) L10Q probably null Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Fndc7 G T 3: 108,783,986 (GRCm39) Q208K probably benign Het
Gins4 A T 8: 23,724,796 (GRCm39) C53S probably damaging Het
Gja8 T A 3: 96,826,351 (GRCm39) probably benign Het
Golph3l T A 3: 95,524,734 (GRCm39) N328K probably benign Het
Haus6 A C 4: 86,503,524 (GRCm39) probably benign Het
Hdac5 A G 11: 102,091,389 (GRCm39) probably benign Het
Ide A G 19: 37,255,155 (GRCm39) Y883H unknown Het
Igf2r A G 17: 12,910,764 (GRCm39) probably null Het
Kif21b G A 1: 136,079,063 (GRCm39) probably null Het
Lancl1 A T 1: 67,060,193 (GRCm39) N77K probably benign Het
Lyst T A 13: 13,812,349 (GRCm39) N920K probably damaging Het
Lyst G A 13: 13,933,963 (GRCm39) V3554I probably benign Het
Map1a G A 2: 121,136,386 (GRCm39) A2163T probably damaging Het
Mapk7 G T 11: 61,384,734 (GRCm39) probably benign Het
Myo10 C A 15: 25,781,204 (GRCm39) Q154K probably damaging Het
Or2a7 C T 6: 43,151,255 (GRCm39) L112F probably benign Het
Or2h15 A G 17: 38,441,441 (GRCm39) I214T probably damaging Het
Pcdhgb2 G A 18: 37,825,267 (GRCm39) V753M probably benign Het
Pnn T A 12: 59,117,013 (GRCm39) L195Q probably damaging Het
Pot1a A G 6: 25,771,540 (GRCm39) V227A possibly damaging Het
Ppp1r21 T A 17: 88,855,049 (GRCm39) D109E probably benign Het
Prr15l G A 11: 96,825,588 (GRCm39) G73S probably damaging Het
Rnf148 A G 6: 23,654,339 (GRCm39) F219S probably benign Het
Rnpep C A 1: 135,194,764 (GRCm39) probably benign Het
Ryr1 T C 7: 28,803,723 (GRCm39) T643A probably damaging Het
Ryr2 A T 13: 11,960,831 (GRCm39) C36S probably damaging Het
Shc3 G T 13: 51,596,805 (GRCm39) T406N probably benign Het
Slit3 G T 11: 35,579,420 (GRCm39) G1199V probably damaging Het
Spata6l G T 19: 28,919,175 (GRCm39) H195N possibly damaging Het
Sptbn5 G A 2: 119,880,601 (GRCm39) noncoding transcript Het
St8sia6 T C 2: 13,670,253 (GRCm39) N236D probably damaging Het
Stpg1 A T 4: 135,233,727 (GRCm39) Q3L probably benign Het
Sult3a1 T A 10: 33,742,550 (GRCm39) I59N probably damaging Het
Vmn1r208 T G 13: 22,956,958 (GRCm39) I180L probably benign Het
Vmn2r51 A T 7: 9,832,247 (GRCm39) N446K probably damaging Het
Vmn2r63 A T 7: 42,553,402 (GRCm39) I618N probably damaging Het
Wrn T C 8: 33,812,371 (GRCm39) N182S probably benign Het
Zfp296 G T 7: 19,313,637 (GRCm39) C164F possibly damaging Het
Zfp764l1 A G 7: 126,992,521 (GRCm39) Y30H probably damaging Het
Zmynd8 A G 2: 165,676,871 (GRCm39) V249A possibly damaging Het
Zswim2 A G 2: 83,755,571 (GRCm39) L110P probably damaging Het
Other mutations in Kdm3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Kdm3b APN 18 34,942,462 (GRCm39) missense probably benign 0.03
IGL01357:Kdm3b APN 18 34,926,067 (GRCm39) missense probably damaging 1.00
IGL01615:Kdm3b APN 18 34,962,284 (GRCm39) missense probably damaging 1.00
IGL01980:Kdm3b APN 18 34,967,289 (GRCm39) missense probably damaging 1.00
IGL02277:Kdm3b APN 18 34,956,717 (GRCm39) missense probably damaging 1.00
IGL02346:Kdm3b APN 18 34,967,291 (GRCm39) missense probably damaging 1.00
IGL02417:Kdm3b APN 18 34,941,630 (GRCm39) missense probably benign 0.03
IGL02531:Kdm3b APN 18 34,928,782 (GRCm39) missense probably benign
IGL02589:Kdm3b APN 18 34,945,471 (GRCm39) missense possibly damaging 0.89
IGL02793:Kdm3b APN 18 34,962,072 (GRCm39) missense probably damaging 0.99
IGL03121:Kdm3b APN 18 34,928,762 (GRCm39) missense probably damaging 0.98
IGL03123:Kdm3b APN 18 34,942,544 (GRCm39) critical splice donor site probably null
IGL03128:Kdm3b APN 18 34,960,480 (GRCm39) missense probably damaging 1.00
Affable UTSW 18 34,926,058 (GRCm39) missense probably damaging 1.00
Dotage UTSW 18 34,960,435 (GRCm39) missense probably damaging 1.00
Endearing UTSW 18 34,960,381 (GRCm39) splice site probably null
Oldtimer UTSW 18 34,956,752 (GRCm39) nonsense probably null
PIT4382001:Kdm3b UTSW 18 34,942,140 (GRCm39) missense probably damaging 1.00
PIT4445001:Kdm3b UTSW 18 34,926,168 (GRCm39) nonsense probably null
R0068:Kdm3b UTSW 18 34,957,827 (GRCm39) missense probably benign 0.18
R0068:Kdm3b UTSW 18 34,957,827 (GRCm39) missense probably benign 0.18
R0233:Kdm3b UTSW 18 34,942,473 (GRCm39) missense probably damaging 0.97
R0265:Kdm3b UTSW 18 34,928,716 (GRCm39) splice site probably benign
R0306:Kdm3b UTSW 18 34,937,070 (GRCm39) missense probably benign 0.35
R0941:Kdm3b UTSW 18 34,936,605 (GRCm39) missense probably damaging 0.99
R0970:Kdm3b UTSW 18 34,942,092 (GRCm39) missense probably damaging 1.00
R1061:Kdm3b UTSW 18 34,929,915 (GRCm39) missense probably damaging 1.00
R1104:Kdm3b UTSW 18 34,952,864 (GRCm39) missense probably damaging 1.00
R1221:Kdm3b UTSW 18 34,941,298 (GRCm39) missense possibly damaging 0.57
R1486:Kdm3b UTSW 18 34,967,357 (GRCm39) missense probably damaging 1.00
R1523:Kdm3b UTSW 18 34,926,226 (GRCm39) critical splice donor site probably null
R1558:Kdm3b UTSW 18 34,942,149 (GRCm39) missense probably damaging 1.00
R1585:Kdm3b UTSW 18 34,942,345 (GRCm39) missense probably damaging 1.00
R1601:Kdm3b UTSW 18 34,941,784 (GRCm39) missense probably damaging 1.00
R1650:Kdm3b UTSW 18 34,942,168 (GRCm39) missense possibly damaging 0.93
R1772:Kdm3b UTSW 18 34,936,557 (GRCm39) missense probably benign 0.01
R1853:Kdm3b UTSW 18 34,966,446 (GRCm39) missense probably damaging 1.00
R1934:Kdm3b UTSW 18 34,946,597 (GRCm39) missense probably benign 0.04
R1959:Kdm3b UTSW 18 34,945,448 (GRCm39) missense possibly damaging 0.55
R2079:Kdm3b UTSW 18 34,936,570 (GRCm39) missense probably damaging 1.00
R2102:Kdm3b UTSW 18 34,963,200 (GRCm39) missense probably damaging 1.00
R2121:Kdm3b UTSW 18 34,929,833 (GRCm39) splice site probably benign
R2281:Kdm3b UTSW 18 34,941,472 (GRCm39) missense probably damaging 1.00
R3719:Kdm3b UTSW 18 34,941,724 (GRCm39) missense probably damaging 1.00
R3755:Kdm3b UTSW 18 34,941,349 (GRCm39) missense probably benign
R3857:Kdm3b UTSW 18 34,966,440 (GRCm39) missense probably benign
R4165:Kdm3b UTSW 18 34,928,797 (GRCm39) missense probably benign 0.01
R4166:Kdm3b UTSW 18 34,928,797 (GRCm39) missense probably benign 0.01
R4372:Kdm3b UTSW 18 34,960,497 (GRCm39) missense probably benign 0.00
R4672:Kdm3b UTSW 18 34,941,630 (GRCm39) missense probably benign
R4969:Kdm3b UTSW 18 34,955,428 (GRCm39) missense probably damaging 1.00
R5009:Kdm3b UTSW 18 34,957,763 (GRCm39) missense probably benign 0.42
R5059:Kdm3b UTSW 18 34,910,250 (GRCm39) missense possibly damaging 0.83
R5092:Kdm3b UTSW 18 34,946,515 (GRCm39) missense probably benign 0.16
R5270:Kdm3b UTSW 18 34,960,467 (GRCm39) missense probably damaging 1.00
R5816:Kdm3b UTSW 18 34,961,522 (GRCm39) missense probably damaging 0.99
R5970:Kdm3b UTSW 18 34,962,342 (GRCm39) missense probably damaging 1.00
R6244:Kdm3b UTSW 18 34,926,058 (GRCm39) missense probably damaging 1.00
R6705:Kdm3b UTSW 18 34,952,926 (GRCm39) missense probably damaging 1.00
R6723:Kdm3b UTSW 18 34,926,058 (GRCm39) missense probably damaging 0.99
R6909:Kdm3b UTSW 18 34,960,381 (GRCm39) splice site probably null
R6958:Kdm3b UTSW 18 34,941,336 (GRCm39) missense probably benign 0.00
R7026:Kdm3b UTSW 18 34,955,517 (GRCm39) missense possibly damaging 0.90
R7289:Kdm3b UTSW 18 34,927,557 (GRCm39) missense probably benign 0.00
R7488:Kdm3b UTSW 18 34,957,934 (GRCm39) missense probably damaging 0.97
R7587:Kdm3b UTSW 18 34,930,080 (GRCm39) splice site probably null
R7695:Kdm3b UTSW 18 34,927,612 (GRCm39) missense possibly damaging 0.86
R7846:Kdm3b UTSW 18 34,942,293 (GRCm39) missense possibly damaging 0.94
R7984:Kdm3b UTSW 18 34,956,752 (GRCm39) nonsense probably null
R7997:Kdm3b UTSW 18 34,941,336 (GRCm39) missense probably benign 0.00
R8035:Kdm3b UTSW 18 34,941,781 (GRCm39) missense probably damaging 1.00
R8064:Kdm3b UTSW 18 34,946,460 (GRCm39) critical splice acceptor site probably null
R8141:Kdm3b UTSW 18 34,961,599 (GRCm39) nonsense probably null
R8302:Kdm3b UTSW 18 34,967,388 (GRCm39) missense probably damaging 1.00
R8328:Kdm3b UTSW 18 34,926,123 (GRCm39) missense probably damaging 1.00
R8443:Kdm3b UTSW 18 34,926,129 (GRCm39) missense probably benign 0.04
R8513:Kdm3b UTSW 18 34,926,129 (GRCm39) missense probably benign 0.04
R8515:Kdm3b UTSW 18 34,926,129 (GRCm39) missense probably benign 0.04
R8523:Kdm3b UTSW 18 34,926,129 (GRCm39) missense probably benign 0.04
R8717:Kdm3b UTSW 18 34,952,840 (GRCm39) missense probably damaging 0.98
R8725:Kdm3b UTSW 18 34,960,435 (GRCm39) missense probably damaging 1.00
R8727:Kdm3b UTSW 18 34,960,435 (GRCm39) missense probably damaging 1.00
R8762:Kdm3b UTSW 18 34,937,157 (GRCm39) missense probably benign
R8835:Kdm3b UTSW 18 34,941,802 (GRCm39) missense probably damaging 1.00
R8918:Kdm3b UTSW 18 34,970,650 (GRCm39) missense probably damaging 1.00
R9015:Kdm3b UTSW 18 34,963,212 (GRCm39) missense probably damaging 1.00
R9144:Kdm3b UTSW 18 34,927,558 (GRCm39) missense probably benign
R9246:Kdm3b UTSW 18 34,941,480 (GRCm39) nonsense probably null
R9376:Kdm3b UTSW 18 34,970,718 (GRCm39) missense probably damaging 0.99
X0028:Kdm3b UTSW 18 34,932,319 (GRCm39) splice site probably null
X0067:Kdm3b UTSW 18 34,956,570 (GRCm39) missense probably benign 0.00
Z1176:Kdm3b UTSW 18 34,942,122 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGAAGGCCCTTTGTCCTC -3'
(R):5'- CCAACTGAGAGACTGACTACTC -3'

Sequencing Primer
(F):5'- CCTTCCCCACGACAGTTGG -3'
(R):5'- CTGAGAGACTGACTACTCTGACAG -3'
Posted On 2016-04-15