Incidental Mutation 'R4934:Chrm3'
ID 380842
Institutional Source Beutler Lab
Gene Symbol Chrm3
Ensembl Gene ENSMUSG00000046159
Gene Name cholinergic receptor, muscarinic 3, cardiac
Synonyms muscarinic acetylcholine receptor 3, Chrm-3, M3R
MMRRC Submission 042534-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R4934 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 9875486-10360847 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 9877414 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 529 (Y529H)
Ref Sequence ENSEMBL: ENSMUSP00000140131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063093] [ENSMUST00000187510]
AlphaFold Q9ERZ3
Predicted Effect probably damaging
Transcript: ENSMUST00000063093
AA Change: Y529H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055579
Gene: ENSMUSG00000046159
AA Change: Y529H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 75 265 8.9e-7 PFAM
Pfam:7TM_GPCR_Srsx 78 270 6e-11 PFAM
Pfam:7tm_1 84 543 6.9e-82 PFAM
low complexity region 564 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187510
AA Change: Y529H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140131
Gene: ENSMUSG00000046159
AA Change: Y529H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 75 265 8.5e-7 PFAM
Pfam:7TM_GPCR_Srsx 78 270 6e-11 PFAM
Pfam:7tm_1 84 543 2.6e-88 PFAM
low complexity region 564 576 N/A INTRINSIC
Meta Mutation Damage Score 0.8831 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency 99% (134/135)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 3 controls smooth muscle contraction and its stimulation causes secretion of glandular tissue. Alternative promoter use and alternative splicing results in multiple transcript variants that have different tissue specificities. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null mice show reduced body weight and gonadal fat pad weight, decreased food intake, and low serum levels of leptin, triglycerides and insulin. Dilated pupils, hydronephrosis, and impaired contractility of smooth muscle are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 125 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428L18Rik A T 1: 31,222,499 probably benign Het
Acy1 T A 9: 106,435,122 I14F probably null Het
Ago1 T C 4: 126,448,859 D193G possibly damaging Het
Arhgap45 A T 10: 80,020,957 H201L probably damaging Het
Armc9 G A 1: 86,213,079 D63N probably damaging Het
Asb17 A T 3: 153,850,699 I148F possibly damaging Het
Atf7ip2 A G 16: 10,241,583 E329G possibly damaging Het
Atp2a1 T A 7: 126,453,428 D373V probably benign Het
BC067074 C A 13: 113,368,348 Q2004K probably damaging Het
Cacna1e G T 1: 154,481,634 Y603* probably null Het
Cbln4 G A 2: 172,038,981 T131I probably damaging Het
Ccdc126 A G 6: 49,334,247 E63G probably damaging Het
Ccl4 T A 11: 83,662,678 S6T unknown Het
Ccnb1 A T 13: 100,781,701 I146K possibly damaging Het
Ccr8 T A 9: 120,094,749 M310K probably benign Het
Cd180 A T 13: 102,739,164 probably null Het
Cd46 G C 1: 195,082,799 probably benign Het
Cebpb A G 2: 167,689,085 M22V probably benign Het
Cep152 A G 2: 125,611,096 I352T possibly damaging Het
Cep295 T G 9: 15,333,160 E1333D probably damaging Het
Ces4a A G 8: 105,137,981 H30R probably benign Het
Chrnb4 T C 9: 55,034,817 Y391C probably benign Het
Clca3a2 A G 3: 144,817,931 Y98H probably damaging Het
Clvs1 C T 4: 9,424,216 H221Y possibly damaging Het
Col3a1 G A 1: 45,339,952 probably benign Het
Cpn2 T G 16: 30,260,526 N119T probably damaging Het
Cubn T A 2: 13,489,910 Q109H probably benign Het
Cyp26b1 A G 6: 84,576,972 V221A possibly damaging Het
Cyp2e1 T G 7: 140,770,117 N238K probably damaging Het
Dst C T 1: 34,208,588 A1693V probably damaging Het
Dync2li1 A G 17: 84,649,255 Q281R probably benign Het
Enpp2 C T 15: 54,882,147 G318S probably damaging Het
F13a1 G T 13: 36,877,762 P676T probably benign Het
Fam189a2 T C 19: 23,973,425 *597W probably null Het
Fam227a T C 15: 79,637,061 H267R possibly damaging Het
Fam78a G A 2: 32,069,415 R228C probably damaging Het
Fbxw25 T C 9: 109,651,637 N325S possibly damaging Het
Foxred1 T C 9: 35,209,914 probably benign Het
Fstl5 T A 3: 76,588,965 V345E probably damaging Het
Fzd8 GAAAAACTCA GA 18: 9,214,492 probably null Het
Gm15448 A G 7: 3,822,677 Y398H probably damaging Het
Hand1 T C 11: 57,831,252 R179G possibly damaging Het
Hk1 G T 10: 62,358,386 probably benign Het
Hmcn1 A C 1: 150,722,535 L1672R probably damaging Het
Hps5 G A 7: 46,769,351 Q297* probably null Het
Iars T A 13: 49,717,984 F699I probably benign Het
Ift140 G A 17: 25,048,488 G620E probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Inpp4a T G 1: 37,387,841 Y628D possibly damaging Het
Itk C T 11: 46,389,325 R29H probably damaging Het
Kcnv1 A G 15: 45,109,248 F413S probably damaging Het
Klhl3 A T 13: 58,102,417 Y4* probably null Het
Lonrf1 C A 8: 36,233,949 C369F probably damaging Het
Magohb A T 6: 131,284,595 probably benign Het
Map3k4 G A 17: 12,271,900 R215C probably damaging Het
Map3k8 A T 18: 4,339,548 S274R possibly damaging Het
Masp1 T G 16: 23,465,076 M470L probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Muc4 A T 16: 32,756,098 probably benign Het
Myo1c T A 11: 75,671,850 V981E probably damaging Het
Nedd9 A T 13: 41,338,935 I27K probably damaging Het
Nkd2 C A 13: 73,822,722 G247V probably damaging Het
Nucb2 A C 7: 116,539,964 Q398P possibly damaging Het
Numa1 T A 7: 102,010,857 D376E probably benign Het
Olfr1188 C T 2: 88,559,586 T39I probably benign Het
Olfr1198 A T 2: 88,746,054 L278* probably null Het
Olfr1475 G A 19: 13,479,592 T202I possibly damaging Het
Olfr263 G A 13: 21,133,071 V99I probably benign Het
Olfr722 T C 14: 49,895,749 T18A probably benign Het
Olfr735 C T 14: 50,345,888 V185M probably damaging Het
Olfr813 A T 10: 129,857,027 N170Y possibly damaging Het
Olfr930 A T 9: 38,930,833 I221F probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pamr1 C T 2: 102,642,204 T616I probably benign Het
Pcnx G A 12: 81,991,825 V1955I possibly damaging Het
Plekha3 T A 2: 76,680,227 D35E possibly damaging Het
Pnpla2 T G 7: 141,458,172 N184K probably damaging Het
Polr3a C T 14: 24,452,624 E1216K probably benign Het
Ppp1r21 A T 17: 88,545,375 S61C probably damaging Het
Ppp1r21 G C 17: 88,545,376 S61T probably damaging Het
Prdm13 G T 4: 21,678,223 probably benign Het
Prss53 T C 7: 127,888,707 N201S probably benign Het
Rab11fip2 A G 19: 59,935,858 L338S probably damaging Het
Rad50 T C 11: 53,684,275 N546S probably benign Het
Ralgapa1 T C 12: 55,762,574 D472G possibly damaging Het
Rexo4 A G 2: 26,960,334 I277T probably damaging Het
Rimbp2 C T 5: 128,788,515 V590I probably benign Het
Ripor3 A G 2: 167,982,816 V864A probably benign Het
Rnpc3 G A 3: 113,624,979 H107Y possibly damaging Het
Ryr1 A T 7: 29,068,095 D2927E probably damaging Het
Samd9l G A 6: 3,375,621 Q547* probably null Het
Scaper T C 9: 55,809,175 E724G probably damaging Het
Secisbp2l C T 2: 125,740,489 V1016I probably damaging Het
Selenoo T A 15: 89,098,767 M499K probably damaging Het
Sema4a T A 3: 88,438,261 D505V probably damaging Het
Sema5a T C 15: 32,679,164 M863T probably damaging Het
Slc24a5 T C 2: 125,088,020 C414R probably damaging Het
Slc34a2 A G 5: 53,067,600 D361G probably damaging Het
Slc5a1 T C 5: 33,104,514 Y20H probably benign Het
Slx4ip A T 2: 137,068,347 probably benign Het
Snx14 T A 9: 88,398,288 E538V probably damaging Het
Sspo C A 6: 48,465,552 L1994I probably damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Stap2 A G 17: 55,997,901 S294P possibly damaging Het
Stat1 C A 1: 52,153,923 Y651* probably null Het
Syne2 A G 12: 75,899,272 T373A probably benign Het
Tacc2 A G 7: 130,728,588 S201G probably damaging Het
Tdpoz3 G A 3: 93,826,980 E321K probably benign Het
Thumpd1 T C 7: 119,716,779 T316A probably benign Het
Tlr3 A T 8: 45,397,035 C866S probably benign Het
Tmprss11g T A 5: 86,496,542 I148F probably benign Het
Topbp1 T A 9: 103,328,369 probably benign Het
Tpm1 T C 9: 67,028,049 probably null Het
Traf3ip2 T A 10: 39,626,100 S81R probably damaging Het
Trim29 T A 9: 43,310,968 N31K probably benign Het
Ubn2 C T 6: 38,490,498 P563S probably benign Het
Usp24 T C 4: 106,426,546 Y2418H probably benign Het
Vmn2r6 T A 3: 64,556,345 D267V probably damaging Het
Wapl T A 14: 34,692,095 C305S probably benign Het
Yme1l1 C A 2: 23,168,321 S155* probably null Het
Ythdf3 T A 3: 16,204,056 H126Q probably damaging Het
Zbtb32 A T 7: 30,591,253 C206S possibly damaging Het
Zfp518a A T 19: 40,914,263 I879F probably benign Het
Zfp651 T C 9: 121,763,979 V455A probably damaging Het
Zfp938 A T 10: 82,226,178 Y203N possibly damaging Het
Other mutations in Chrm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Chrm3 APN 13 9878598 missense possibly damaging 0.80
IGL02266:Chrm3 APN 13 9877278 missense probably damaging 0.99
IGL02701:Chrm3 APN 13 9878464 nonsense probably null
IGL03085:Chrm3 APN 13 9877534 missense probably damaging 1.00
IGL03213:Chrm3 APN 13 9878184 missense probably benign 0.22
R0147:Chrm3 UTSW 13 9878744 missense probably damaging 1.00
R0408:Chrm3 UTSW 13 9877933 missense probably benign 0.10
R0544:Chrm3 UTSW 13 9877579 missense probably damaging 0.99
R1557:Chrm3 UTSW 13 9878314 missense possibly damaging 0.82
R1647:Chrm3 UTSW 13 9878425 missense probably damaging 1.00
R1697:Chrm3 UTSW 13 9878758 missense probably damaging 1.00
R1791:Chrm3 UTSW 13 9877416 missense probably damaging 1.00
R1866:Chrm3 UTSW 13 9878481 missense probably damaging 1.00
R2049:Chrm3 UTSW 13 9878335 missense probably damaging 1.00
R2909:Chrm3 UTSW 13 9877997 missense probably benign 0.43
R4212:Chrm3 UTSW 13 9877755 missense probably benign 0.01
R4422:Chrm3 UTSW 13 9878555 nonsense probably null
R4790:Chrm3 UTSW 13 9877662 missense probably benign 0.10
R5353:Chrm3 UTSW 13 9878557 missense probably damaging 1.00
R5623:Chrm3 UTSW 13 9877387 missense possibly damaging 0.92
R6154:Chrm3 UTSW 13 9878440 missense possibly damaging 0.88
R6416:Chrm3 UTSW 13 9877662 missense probably benign
R6693:Chrm3 UTSW 13 9877422 missense probably benign 0.27
R7135:Chrm3 UTSW 13 9877801 missense probably benign 0.00
R7297:Chrm3 UTSW 13 9877833 missense probably benign 0.01
R7423:Chrm3 UTSW 13 9878809 missense probably benign
R7591:Chrm3 UTSW 13 9877313 nonsense probably null
R8353:Chrm3 UTSW 13 9877231 makesense probably null
R8355:Chrm3 UTSW 13 9878610 missense probably damaging 1.00
R8446:Chrm3 UTSW 13 9878302 missense probably damaging 0.99
R8453:Chrm3 UTSW 13 9877231 makesense probably null
R9227:Chrm3 UTSW 13 9878443 missense probably benign 0.00
R9230:Chrm3 UTSW 13 9878443 missense probably benign 0.00
R9336:Chrm3 UTSW 13 9878616 missense probably damaging 1.00
R9462:Chrm3 UTSW 13 9877401 missense
R9537:Chrm3 UTSW 13 9877426 missense probably damaging 1.00
R9586:Chrm3 UTSW 13 9877444 missense probably damaging 1.00
X0066:Chrm3 UTSW 13 9877720 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TAAACCCCTTTTCTACAAGGCC -3'
(R):5'- ACGCTGGCTAAGAGGTTTGC -3'

Sequencing Primer
(F):5'- TTTCTACAAGGCCTGCTCAG -3'
(R):5'- AGGTTTGCTCTCAAGACCAG -3'
Posted On 2016-04-15