Incidental Mutation 'R4934:F13a1'
ID380844
Institutional Source Beutler Lab
Gene Symbol F13a1
Ensembl Gene ENSMUSG00000039109
Gene Namecoagulation factor XIII, A1 subunit
SynonymsFactor XIIIA, 1200014I03Rik
MMRRC Submission 042534-MU
Accession Numbers

Genbank: NM_028784; MGI: 1921395

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4934 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location36867178-37050244 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 36877762 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 676 (P676T)
Ref Sequence ENSEMBL: ENSMUSP00000128316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037491] [ENSMUST00000164727]
Predicted Effect probably benign
Transcript: ENSMUST00000037491
AA Change: P676T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000048667
Gene: ENSMUSG00000039109
AA Change: P676T

DomainStartEndE-ValueType
Pfam:Transglut_N 47 165 9e-34 PFAM
TGc 307 400 2.01e-45 SMART
Pfam:Transglut_C 519 623 2e-26 PFAM
Pfam:Transglut_C 631 728 1.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164727
AA Change: P676T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000128316
Gene: ENSMUSG00000039109
AA Change: P676T

DomainStartEndE-ValueType
Pfam:Transglut_N 46 167 3e-38 PFAM
TGc 307 400 2.01e-45 SMART
Pfam:Transglut_C 519 623 2.2e-23 PFAM
Pfam:Transglut_C 631 728 1.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225846
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency 99% (134/135)
MGI Phenotype FUNCTION: This gene encodes subunit A of the coagulation factor XIII that catalyzes the final step of the blood coagulation pathway. The encoded protein associates with subunit B to form a heterotetrameric proenzyme that undergoes thrombin-mediated proteolysis to generate active factor XIIIa. The transglutaminase activity of factor XIIIa is required for the calcium-dependent crosslinking of fibrin, leading to the formation of a clot. Mice lacking the encoded protein display impaired reproduction and reduced survival due to bleeding episodes, hematothorax, hematoperitoneum and subcutaneous hemorrhage. Additionally, mice lacking the encoded protein exhibit impaired wound healing and inadequate healing of myocardial infarction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutant mice exhibit bleeding symptoms, increased lethality, and impaired fertility. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 125 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428L18Rik A T 1: 31,222,499 probably benign Het
Acy1 T A 9: 106,435,122 I14F probably null Het
Ago1 T C 4: 126,448,859 D193G possibly damaging Het
Arhgap45 A T 10: 80,020,957 H201L probably damaging Het
Armc9 G A 1: 86,213,079 D63N probably damaging Het
Asb17 A T 3: 153,850,699 I148F possibly damaging Het
Atf7ip2 A G 16: 10,241,583 E329G possibly damaging Het
Atp2a1 T A 7: 126,453,428 D373V probably benign Het
BC067074 C A 13: 113,368,348 Q2004K probably damaging Het
Cacna1e G T 1: 154,481,634 Y603* probably null Het
Cbln4 G A 2: 172,038,981 T131I probably damaging Het
Ccdc126 A G 6: 49,334,247 E63G probably damaging Het
Ccl4 T A 11: 83,662,678 S6T unknown Het
Ccnb1 A T 13: 100,781,701 I146K possibly damaging Het
Ccr8 T A 9: 120,094,749 M310K probably benign Het
Cd180 A T 13: 102,739,164 probably null Het
Cd46 G C 1: 195,082,799 probably benign Het
Cebpb A G 2: 167,689,085 M22V probably benign Het
Cep152 A G 2: 125,611,096 I352T possibly damaging Het
Cep295 T G 9: 15,333,160 E1333D probably damaging Het
Ces4a A G 8: 105,137,981 H30R probably benign Het
Chrm3 A G 13: 9,877,414 Y529H probably damaging Het
Chrnb4 T C 9: 55,034,817 Y391C probably benign Het
Clca3a2 A G 3: 144,817,931 Y98H probably damaging Het
Clvs1 C T 4: 9,424,216 H221Y possibly damaging Het
Col3a1 G A 1: 45,339,952 probably benign Het
Cpn2 T G 16: 30,260,526 N119T probably damaging Het
Cubn T A 2: 13,489,910 Q109H probably benign Het
Cyp26b1 A G 6: 84,576,972 V221A possibly damaging Het
Cyp2e1 T G 7: 140,770,117 N238K probably damaging Het
Dst C T 1: 34,208,588 A1693V probably damaging Het
Dync2li1 A G 17: 84,649,255 Q281R probably benign Het
Enpp2 C T 15: 54,882,147 G318S probably damaging Het
Fam189a2 T C 19: 23,973,425 *597W probably null Het
Fam227a T C 15: 79,637,061 H267R possibly damaging Het
Fam78a G A 2: 32,069,415 R228C probably damaging Het
Fbxw25 T C 9: 109,651,637 N325S possibly damaging Het
Foxred1 T C 9: 35,209,914 probably benign Het
Fstl5 T A 3: 76,588,965 V345E probably damaging Het
Fzd8 GAAAAACTCA GA 18: 9,214,492 probably null Het
Gm15448 A G 7: 3,822,677 Y398H probably damaging Het
Hand1 T C 11: 57,831,252 R179G possibly damaging Het
Hk1 G T 10: 62,358,386 probably benign Het
Hmcn1 A C 1: 150,722,535 L1672R probably damaging Het
Hps5 G A 7: 46,769,351 Q297* probably null Het
Iars T A 13: 49,717,984 F699I probably benign Het
Ift140 G A 17: 25,048,488 G620E probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Inpp4a T G 1: 37,387,841 Y628D possibly damaging Het
Itk C T 11: 46,389,325 R29H probably damaging Het
Kcnv1 A G 15: 45,109,248 F413S probably damaging Het
Klhl3 A T 13: 58,102,417 Y4* probably null Het
Lonrf1 C A 8: 36,233,949 C369F probably damaging Het
Magohb A T 6: 131,284,595 probably benign Het
Map3k4 G A 17: 12,271,900 R215C probably damaging Het
Map3k8 A T 18: 4,339,548 S274R possibly damaging Het
Masp1 T G 16: 23,465,076 M470L probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Muc4 A T 16: 32,756,098 probably benign Het
Myo1c T A 11: 75,671,850 V981E probably damaging Het
Nedd9 A T 13: 41,338,935 I27K probably damaging Het
Nkd2 C A 13: 73,822,722 G247V probably damaging Het
Nucb2 A C 7: 116,539,964 Q398P possibly damaging Het
Numa1 T A 7: 102,010,857 D376E probably benign Het
Olfr1188 C T 2: 88,559,586 T39I probably benign Het
Olfr1198 A T 2: 88,746,054 L278* probably null Het
Olfr1475 G A 19: 13,479,592 T202I possibly damaging Het
Olfr263 G A 13: 21,133,071 V99I probably benign Het
Olfr722 T C 14: 49,895,749 T18A probably benign Het
Olfr735 C T 14: 50,345,888 V185M probably damaging Het
Olfr813 A T 10: 129,857,027 N170Y possibly damaging Het
Olfr930 A T 9: 38,930,833 I221F probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pamr1 C T 2: 102,642,204 T616I probably benign Het
Pcnx G A 12: 81,991,825 V1955I possibly damaging Het
Plekha3 T A 2: 76,680,227 D35E possibly damaging Het
Pnpla2 T G 7: 141,458,172 N184K probably damaging Het
Polr3a C T 14: 24,452,624 E1216K probably benign Het
Ppp1r21 A T 17: 88,545,375 S61C probably damaging Het
Ppp1r21 G C 17: 88,545,376 S61T probably damaging Het
Prdm13 G T 4: 21,678,223 probably benign Het
Prss53 T C 7: 127,888,707 N201S probably benign Het
Rab11fip2 A G 19: 59,935,858 L338S probably damaging Het
Rad50 T C 11: 53,684,275 N546S probably benign Het
Ralgapa1 T C 12: 55,762,574 D472G possibly damaging Het
Rexo4 A G 2: 26,960,334 I277T probably damaging Het
Rimbp2 C T 5: 128,788,515 V590I probably benign Het
Ripor3 A G 2: 167,982,816 V864A probably benign Het
Rnpc3 G A 3: 113,624,979 H107Y possibly damaging Het
Ryr1 A T 7: 29,068,095 D2927E probably damaging Het
Samd9l G A 6: 3,375,621 Q547* probably null Het
Scaper T C 9: 55,809,175 E724G probably damaging Het
Secisbp2l C T 2: 125,740,489 V1016I probably damaging Het
Selenoo T A 15: 89,098,767 M499K probably damaging Het
Sema4a T A 3: 88,438,261 D505V probably damaging Het
Sema5a T C 15: 32,679,164 M863T probably damaging Het
Slc24a5 T C 2: 125,088,020 C414R probably damaging Het
Slc34a2 A G 5: 53,067,600 D361G probably damaging Het
Slc5a1 T C 5: 33,104,514 Y20H probably benign Het
Slx4ip A T 2: 137,068,347 probably benign Het
Snx14 T A 9: 88,398,288 E538V probably damaging Het
Sspo C A 6: 48,465,552 L1994I probably damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Stap2 A G 17: 55,997,901 S294P possibly damaging Het
Stat1 C A 1: 52,153,923 Y651* probably null Het
Syne2 A G 12: 75,899,272 T373A probably benign Het
Tacc2 A G 7: 130,728,588 S201G probably damaging Het
Tdpoz3 G A 3: 93,826,980 E321K probably benign Het
Thumpd1 T C 7: 119,716,779 T316A probably benign Het
Tlr3 A T 8: 45,397,035 C866S probably benign Het
Tmprss11g T A 5: 86,496,542 I148F probably benign Het
Topbp1 T A 9: 103,328,369 probably benign Het
Tpm1 T C 9: 67,028,049 probably null Het
Traf3ip2 T A 10: 39,626,100 S81R probably damaging Het
Trim29 T A 9: 43,310,968 N31K probably benign Het
Ubn2 C T 6: 38,490,498 P563S probably benign Het
Usp24 T C 4: 106,426,546 Y2418H probably benign Het
Vmn2r6 T A 3: 64,556,345 D267V probably damaging Het
Wapl T A 14: 34,692,095 C305S probably benign Het
Yme1l1 C A 2: 23,168,321 S155* probably null Het
Ythdf3 T A 3: 16,204,056 H126Q probably damaging Het
Zbtb32 A T 7: 30,591,253 C206S possibly damaging Het
Zfp518a A T 19: 40,914,263 I879F probably benign Het
Zfp651 T C 9: 121,763,979 V455A probably damaging Het
Zfp938 A T 10: 82,226,178 Y203N possibly damaging Het
Other mutations in F13a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:F13a1 APN 13 36988878 missense probably benign 0.11
IGL01444:F13a1 APN 13 36918577 missense probably null 1.00
IGL02188:F13a1 APN 13 36906061 splice site probably benign
IGL02591:F13a1 APN 13 36898057 missense probably damaging 1.00
IGL02660:F13a1 APN 13 36943894 missense possibly damaging 0.92
IGL03244:F13a1 APN 13 36988896 missense possibly damaging 0.82
IGL03401:F13a1 APN 13 36898080 missense probably benign 0.00
F6893:F13a1 UTSW 13 36972025 missense probably damaging 1.00
R0082:F13a1 UTSW 13 36988953 missense probably damaging 0.99
R0657:F13a1 UTSW 13 36968105 missense probably damaging 0.96
R1225:F13a1 UTSW 13 37025851 missense probably benign
R1430:F13a1 UTSW 13 36898131 missense probably damaging 1.00
R1608:F13a1 UTSW 13 36868811 missense probably damaging 1.00
R1883:F13a1 UTSW 13 36989007 missense probably benign 0.01
R2115:F13a1 UTSW 13 36988857 missense probably damaging 1.00
R2121:F13a1 UTSW 13 37025679 missense probably benign 0.01
R2122:F13a1 UTSW 13 37025679 missense probably benign 0.01
R2125:F13a1 UTSW 13 36892841 missense probably benign 0.15
R2392:F13a1 UTSW 13 36943997 missense possibly damaging 0.65
R3618:F13a1 UTSW 13 36943993 missense probably damaging 1.00
R3625:F13a1 UTSW 13 36898093 missense probably benign 0.31
R3772:F13a1 UTSW 13 36898134 missense probably benign
R3838:F13a1 UTSW 13 37047424 missense probably damaging 1.00
R3857:F13a1 UTSW 13 37025694 missense probably benign 0.32
R3937:F13a1 UTSW 13 36916901 missense probably damaging 1.00
R4974:F13a1 UTSW 13 36916863 critical splice donor site probably null
R5033:F13a1 UTSW 13 36988856 missense probably damaging 1.00
R5194:F13a1 UTSW 13 36972063 missense probably damaging 1.00
R5740:F13a1 UTSW 13 36898204 missense probably benign 0.02
R5753:F13a1 UTSW 13 36898108 nonsense probably null
R6188:F13a1 UTSW 13 37025778 missense probably benign 0.12
R7048:F13a1 UTSW 13 36898143 missense probably benign 0.02
R7197:F13a1 UTSW 13 36916886 missense probably damaging 1.00
Z1088:F13a1 UTSW 13 36989012 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTGTTAGACCCACCCTGTTTC -3'
(R):5'- CAGAAATGTTGTGCTGTGGC -3'

Sequencing Primer
(F):5'- CTATCTATCGATGTAAGAGATAGGCG -3'
(R):5'- GCTAATGAGCTGTGTTGTCATCTAAC -3'
Posted On2016-04-15