Incidental Mutation 'R0399:C4b'
ID38085
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
MMRRC Submission 038604-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0399 (G1)
Quality Score220
Status Validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34728869 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 1657 (Q1657H)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect probably damaging
Transcript: ENSMUST00000069507
AA Change: Q1657H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: Q1657H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173669
Meta Mutation Damage Score 0.1797 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 99% (71/72)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,750,959 probably benign Het
6030452D12Rik T C 8: 106,504,542 M120T unknown Het
Actr1a A T 19: 46,385,011 probably null Het
AI314180 T C 4: 58,827,047 T1029A possibly damaging Het
Anapc5 A T 5: 122,791,753 V555D probably damaging Het
Aox1 A G 1: 58,068,849 probably null Het
Arhgap30 A G 1: 171,404,816 E343G probably damaging Het
Asap2 C T 12: 21,217,997 T291I possibly damaging Het
Atp5a1 T A 18: 77,781,836 Y439* probably null Het
Auts2 A T 5: 131,440,524 S428T probably benign Het
B3gnt7 T A 1: 86,305,711 C109* probably null Het
Cadm2 A T 16: 66,747,339 L268* probably null Het
Cep290 G A 10: 100,554,400 probably benign Het
Cep68 T G 11: 20,230,571 I687L probably benign Het
Chd6 T A 2: 161,052,688 D84V probably damaging Het
Clpx A G 9: 65,322,769 T514A probably benign Het
Cox18 A T 5: 90,215,028 C324S probably benign Het
Cryzl2 T C 1: 157,462,016 Y75H probably damaging Het
Cxcr6 C T 9: 123,810,951 A339V possibly damaging Het
Dock1 T C 7: 135,163,442 L1721P probably benign Het
Dstyk T C 1: 132,453,080 probably benign Het
Ehf A G 2: 103,266,870 Y246H probably damaging Het
Epas1 T C 17: 86,805,193 V73A probably benign Het
Filip1 A G 9: 79,818,310 I1009T possibly damaging Het
Glis3 A T 19: 28,298,768 probably benign Het
Gm17333 A T 16: 77,852,790 noncoding transcript Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Gpr155 A T 2: 73,370,002 I387N possibly damaging Het
Gria1 A G 11: 57,186,027 D83G probably damaging Het
Grid2 A G 6: 64,666,052 I933V probably benign Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Hook2 A G 8: 84,993,567 probably benign Het
Ift140 T A 17: 25,050,340 S656R possibly damaging Het
Il11ra1 A T 4: 41,766,185 T241S probably benign Het
Kank1 A G 19: 25,411,242 I760V probably benign Het
Kansl1 T C 11: 104,424,132 E360G possibly damaging Het
Klf9 A T 19: 23,142,082 S110C probably damaging Het
Klhl31 A G 9: 77,650,653 N217S probably benign Het
Lct T C 1: 128,300,525 Y1077C probably damaging Het
Lrrc49 A T 9: 60,610,246 probably benign Het
Lrrn1 T A 6: 107,569,120 H626Q probably benign Het
Mmp28 A T 11: 83,451,732 L40Q probably damaging Het
Mroh1 C T 15: 76,452,099 A1530V probably benign Het
Myo1e A G 9: 70,301,793 probably benign Het
Naa25 A T 5: 121,435,490 M761L probably benign Het
Ncln G A 10: 81,488,297 A465V probably damaging Het
Nktr A G 9: 121,731,484 N98S probably damaging Het
Olfr1012 T C 2: 85,759,904 I157M possibly damaging Het
Olfr215 C A 6: 116,582,781 S55I probably benign Het
Olfr651 T A 7: 104,553,369 V150E probably benign Het
Olfr76 G C 19: 12,120,370 A114G possibly damaging Het
Olfr878 G T 9: 37,919,553 A304S possibly damaging Het
Pacsin2 T C 15: 83,386,782 Y222C probably damaging Het
Pcdhb15 C T 18: 37,474,168 T151M possibly damaging Het
Plcz1 C A 6: 140,023,230 V161L possibly damaging Het
Ppp6c G A 2: 39,200,124 probably benign Het
Rhbdf2 T A 11: 116,603,992 Y286F probably benign Het
Rtn3 A T 19: 7,457,876 D231E probably damaging Het
Slc35c2 A C 2: 165,280,895 Y156* probably null Het
Spata46 A G 1: 170,311,537 D35G probably damaging Het
Tmed3 A G 9: 89,702,873 F110L possibly damaging Het
Tmem104 T G 11: 115,201,308 probably benign Het
Tpbg T A 9: 85,844,938 V320E possibly damaging Het
Trib2 T C 12: 15,793,663 D190G probably damaging Het
Tspan2 A G 3: 102,759,385 T26A probably damaging Het
Usp17lb A C 7: 104,841,151 Y190D possibly damaging Het
Utp18 C T 11: 93,880,147 probably benign Het
Utp20 A T 10: 88,820,979 D121E probably damaging Het
Vmn1r80 T A 7: 12,193,317 M118K possibly damaging Het
Vmn1r84 T C 7: 12,361,867 S300G probably benign Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
Aspiration UTSW 17 34734442 missense probably benign 0.00
Inspiration UTSW 17 34732166 splice site probably null
perspiration UTSW 17 34729831 missense probably damaging 1.00
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
R6962:C4b UTSW 17 34732166 splice site probably null
R7068:C4b UTSW 17 34733477 missense probably damaging 1.00
R7081:C4b UTSW 17 34735443 missense probably benign 0.27
R7105:C4b UTSW 17 34730911 missense possibly damaging 0.52
R7211:C4b UTSW 17 34735534 missense possibly damaging 0.92
R7296:C4b UTSW 17 34743659 missense probably damaging 1.00
R7314:C4b UTSW 17 34740356 missense probably benign
R7330:C4b UTSW 17 34730472 missense probably damaging 1.00
R7397:C4b UTSW 17 34742390 missense possibly damaging 0.80
R7437:C4b UTSW 17 34734733 missense probably benign 0.10
R7490:C4b UTSW 17 34731080 nonsense probably null
R7597:C4b UTSW 17 34739675 missense probably benign
R7633:C4b UTSW 17 34729399 critical splice donor site probably null
R7900:C4b UTSW 17 34739777 missense probably benign 0.03
R7910:C4b UTSW 17 34740352 missense probably benign 0.00
R7983:C4b UTSW 17 34739777 missense probably benign 0.03
R7991:C4b UTSW 17 34740352 missense probably benign 0.00
Z1176:C4b UTSW 17 34731147 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCCCAAAAGGAAGGTCACAGGTATG -3'
(R):5'- CGTCTCTTTGAGTCCAAGATCACCC -3'

Sequencing Primer
(F):5'- GTCACAGGTATGAGGAGAGC -3'
(R):5'- CAAGTCCTGCATTTCAGTAGGAAG -3'
Posted On2013-05-23