Incidental Mutation 'R4934:BC067074'
ID380850
Institutional Source Beutler Lab
Gene Symbol BC067074
Ensembl Gene ENSMUSG00000021763
Gene NamecDNA sequence BC067074
Synonyms
MMRRC Submission 042534-MU
Accession Numbers

Ncbi RefSeq: none; VEGA: OTTMUST00000084794; MGI:3040697

Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R4934 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location113293159-113379711 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 113368348 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 2004 (Q2004K)
Ref Sequence ENSEMBL: ENSMUSP00000119993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078163] [ENSMUST00000136755]
Predicted Effect probably damaging
Transcript: ENSMUST00000078163
AA Change: Q462K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077297
Gene: ENSMUSG00000021763
AA Change: Q462K

DomainStartEndE-ValueType
Pfam:Cadherin_3 29 136 4.6e-12 PFAM
low complexity region 190 198 N/A INTRINSIC
Pfam:Cadherin_3 231 384 4.9e-38 PFAM
transmembrane domain 725 747 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135096
SMART Domains Protein: ENSMUSP00000131959
Gene: ENSMUSG00000021763

DomainStartEndE-ValueType
Pfam:Cadherin_3 1 86 1.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136755
AA Change: Q2004K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119993
Gene: ENSMUSG00000021763
AA Change: Q2004K

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LamG 44 177 1.28e-20 SMART
LamG 229 371 4.66e-14 SMART
low complexity region 407 420 N/A INTRINSIC
Pfam:Cadherin_3 492 644 2.1e-35 PFAM
Pfam:Cadherin_3 647 759 1e-7 PFAM
Pfam:Cadherin_3 741 873 1.2e-8 PFAM
Pfam:Cadherin_3 861 989 4.1e-14 PFAM
Pfam:Cadherin_3 958 1114 1.2e-20 PFAM
Pfam:Cadherin_3 1117 1223 1.6e-10 PFAM
Pfam:Cadherin_3 1212 1341 5.6e-12 PFAM
Pfam:Cadherin_3 1347 1438 3.8e-8 PFAM
Pfam:Cadherin_3 1419 1562 2.3e-45 PFAM
Pfam:Cadherin_3 1576 1679 2.1e-9 PFAM
low complexity region 1732 1740 N/A INTRINSIC
Pfam:Cadherin_3 1773 1926 3e-35 PFAM
transmembrane domain 2267 2289 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency 99% (134/135)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 125 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428L18Rik A T 1: 31,222,499 probably benign Het
Acy1 T A 9: 106,435,122 I14F probably null Het
Ago1 T C 4: 126,448,859 D193G possibly damaging Het
Arhgap45 A T 10: 80,020,957 H201L probably damaging Het
Armc9 G A 1: 86,213,079 D63N probably damaging Het
Asb17 A T 3: 153,850,699 I148F possibly damaging Het
Atf7ip2 A G 16: 10,241,583 E329G possibly damaging Het
Atp2a1 T A 7: 126,453,428 D373V probably benign Het
Cacna1e G T 1: 154,481,634 Y603* probably null Het
Cbln4 G A 2: 172,038,981 T131I probably damaging Het
Ccdc126 A G 6: 49,334,247 E63G probably damaging Het
Ccl4 T A 11: 83,662,678 S6T unknown Het
Ccnb1 A T 13: 100,781,701 I146K possibly damaging Het
Ccr8 T A 9: 120,094,749 M310K probably benign Het
Cd180 A T 13: 102,739,164 probably null Het
Cd46 G C 1: 195,082,799 probably benign Het
Cebpb A G 2: 167,689,085 M22V probably benign Het
Cep152 A G 2: 125,611,096 I352T possibly damaging Het
Cep295 T G 9: 15,333,160 E1333D probably damaging Het
Ces4a A G 8: 105,137,981 H30R probably benign Het
Chrm3 A G 13: 9,877,414 Y529H probably damaging Het
Chrnb4 T C 9: 55,034,817 Y391C probably benign Het
Clca3a2 A G 3: 144,817,931 Y98H probably damaging Het
Clvs1 C T 4: 9,424,216 H221Y possibly damaging Het
Col3a1 G A 1: 45,339,952 probably benign Het
Cpn2 T G 16: 30,260,526 N119T probably damaging Het
Cubn T A 2: 13,489,910 Q109H probably benign Het
Cyp26b1 A G 6: 84,576,972 V221A possibly damaging Het
Cyp2e1 T G 7: 140,770,117 N238K probably damaging Het
Dst C T 1: 34,208,588 A1693V probably damaging Het
Dync2li1 A G 17: 84,649,255 Q281R probably benign Het
Enpp2 C T 15: 54,882,147 G318S probably damaging Het
F13a1 G T 13: 36,877,762 P676T probably benign Het
Fam189a2 T C 19: 23,973,425 *597W probably null Het
Fam227a T C 15: 79,637,061 H267R possibly damaging Het
Fam78a G A 2: 32,069,415 R228C probably damaging Het
Fbxw25 T C 9: 109,651,637 N325S possibly damaging Het
Foxred1 T C 9: 35,209,914 probably benign Het
Fstl5 T A 3: 76,588,965 V345E probably damaging Het
Fzd8 GAAAAACTCA GA 18: 9,214,492 probably null Het
Gm15448 A G 7: 3,822,677 Y398H probably damaging Het
Hand1 T C 11: 57,831,252 R179G possibly damaging Het
Hk1 G T 10: 62,358,386 probably benign Het
Hmcn1 A C 1: 150,722,535 L1672R probably damaging Het
Hps5 G A 7: 46,769,351 Q297* probably null Het
Iars T A 13: 49,717,984 F699I probably benign Het
Ift140 G A 17: 25,048,488 G620E probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Inpp4a T G 1: 37,387,841 Y628D possibly damaging Het
Itk C T 11: 46,389,325 R29H probably damaging Het
Kcnv1 A G 15: 45,109,248 F413S probably damaging Het
Klhl3 A T 13: 58,102,417 Y4* probably null Het
Lonrf1 C A 8: 36,233,949 C369F probably damaging Het
Magohb A T 6: 131,284,595 probably benign Het
Map3k4 G A 17: 12,271,900 R215C probably damaging Het
Map3k8 A T 18: 4,339,548 S274R possibly damaging Het
Masp1 T G 16: 23,465,076 M470L probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Muc4 A T 16: 32,756,098 probably benign Het
Myo1c T A 11: 75,671,850 V981E probably damaging Het
Nedd9 A T 13: 41,338,935 I27K probably damaging Het
Nkd2 C A 13: 73,822,722 G247V probably damaging Het
Nucb2 A C 7: 116,539,964 Q398P possibly damaging Het
Numa1 T A 7: 102,010,857 D376E probably benign Het
Olfr1188 C T 2: 88,559,586 T39I probably benign Het
Olfr1198 A T 2: 88,746,054 L278* probably null Het
Olfr1475 G A 19: 13,479,592 T202I possibly damaging Het
Olfr263 G A 13: 21,133,071 V99I probably benign Het
Olfr722 T C 14: 49,895,749 T18A probably benign Het
Olfr735 C T 14: 50,345,888 V185M probably damaging Het
Olfr813 A T 10: 129,857,027 N170Y possibly damaging Het
Olfr930 A T 9: 38,930,833 I221F probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pamr1 C T 2: 102,642,204 T616I probably benign Het
Pcnx G A 12: 81,991,825 V1955I possibly damaging Het
Plekha3 T A 2: 76,680,227 D35E possibly damaging Het
Pnpla2 T G 7: 141,458,172 N184K probably damaging Het
Polr3a C T 14: 24,452,624 E1216K probably benign Het
Ppp1r21 A T 17: 88,545,375 S61C probably damaging Het
Ppp1r21 G C 17: 88,545,376 S61T probably damaging Het
Prdm13 G T 4: 21,678,223 probably benign Het
Prss53 T C 7: 127,888,707 N201S probably benign Het
Rab11fip2 A G 19: 59,935,858 L338S probably damaging Het
Rad50 T C 11: 53,684,275 N546S probably benign Het
Ralgapa1 T C 12: 55,762,574 D472G possibly damaging Het
Rexo4 A G 2: 26,960,334 I277T probably damaging Het
Rimbp2 C T 5: 128,788,515 V590I probably benign Het
Ripor3 A G 2: 167,982,816 V864A probably benign Het
Rnpc3 G A 3: 113,624,979 H107Y possibly damaging Het
Ryr1 A T 7: 29,068,095 D2927E probably damaging Het
Samd9l G A 6: 3,375,621 Q547* probably null Het
Scaper T C 9: 55,809,175 E724G probably damaging Het
Secisbp2l C T 2: 125,740,489 V1016I probably damaging Het
Selenoo T A 15: 89,098,767 M499K probably damaging Het
Sema4a T A 3: 88,438,261 D505V probably damaging Het
Sema5a T C 15: 32,679,164 M863T probably damaging Het
Slc24a5 T C 2: 125,088,020 C414R probably damaging Het
Slc34a2 A G 5: 53,067,600 D361G probably damaging Het
Slc5a1 T C 5: 33,104,514 Y20H probably benign Het
Slx4ip A T 2: 137,068,347 probably benign Het
Snx14 T A 9: 88,398,288 E538V probably damaging Het
Sspo C A 6: 48,465,552 L1994I probably damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Stap2 A G 17: 55,997,901 S294P possibly damaging Het
Stat1 C A 1: 52,153,923 Y651* probably null Het
Syne2 A G 12: 75,899,272 T373A probably benign Het
Tacc2 A G 7: 130,728,588 S201G probably damaging Het
Tdpoz3 G A 3: 93,826,980 E321K probably benign Het
Thumpd1 T C 7: 119,716,779 T316A probably benign Het
Tlr3 A T 8: 45,397,035 C866S probably benign Het
Tmprss11g T A 5: 86,496,542 I148F probably benign Het
Topbp1 T A 9: 103,328,369 probably benign Het
Tpm1 T C 9: 67,028,049 probably null Het
Traf3ip2 T A 10: 39,626,100 S81R probably damaging Het
Trim29 T A 9: 43,310,968 N31K probably benign Het
Ubn2 C T 6: 38,490,498 P563S probably benign Het
Usp24 T C 4: 106,426,546 Y2418H probably benign Het
Vmn2r6 T A 3: 64,556,345 D267V probably damaging Het
Wapl T A 14: 34,692,095 C305S probably benign Het
Yme1l1 C A 2: 23,168,321 S155* probably null Het
Ythdf3 T A 3: 16,204,056 H126Q probably damaging Het
Zbtb32 A T 7: 30,591,253 C206S possibly damaging Het
Zfp518a A T 19: 40,914,263 I879F probably benign Het
Zfp651 T C 9: 121,763,979 V455A probably damaging Het
Zfp938 A T 10: 82,226,178 Y203N possibly damaging Het
Other mutations in BC067074
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:BC067074 APN 13 113367557 missense possibly damaging 0.91
IGL03023:BC067074 APN 13 113351741 missense probably benign 0.03
cumpleanos UTSW 13 113368336 missense possibly damaging 0.87
Sorpresa UTSW 13 113318191 missense probably damaging 1.00
P0018:BC067074 UTSW 13 113367506 missense possibly damaging 0.60
R0003:BC067074 UTSW 13 113368776 missense probably benign 0.00
R0016:BC067074 UTSW 13 113366105 missense probably damaging 1.00
R0016:BC067074 UTSW 13 113366105 missense probably damaging 1.00
R0053:BC067074 UTSW 13 113368489 missense probably benign 0.00
R0053:BC067074 UTSW 13 113368489 missense probably benign 0.00
R0158:BC067074 UTSW 13 113369153 nonsense probably null
R0281:BC067074 UTSW 13 113369143 missense probably damaging 1.00
R1212:BC067074 UTSW 13 113369417 intron probably benign
R1300:BC067074 UTSW 13 113366160 missense probably damaging 1.00
R1434:BC067074 UTSW 13 113368492 missense possibly damaging 0.46
R1509:BC067074 UTSW 13 113368256 missense probably damaging 0.99
R1738:BC067074 UTSW 13 113367500 missense possibly damaging 0.69
R1758:BC067074 UTSW 13 113368732 missense possibly damaging 0.78
R1828:BC067074 UTSW 13 113368808 missense probably damaging 1.00
R2061:BC067074 UTSW 13 113318094 missense probably damaging 0.99
R2570:BC067074 UTSW 13 113318587 missense probably benign 0.34
R2884:BC067074 UTSW 13 113320682 missense probably damaging 1.00
R2884:BC067074 UTSW 13 113369191 missense probably benign 0.00
R3004:BC067074 UTSW 13 113366154 missense probably damaging 1.00
R3150:BC067074 UTSW 13 113351760 missense probably damaging 1.00
R3773:BC067074 UTSW 13 113318209 missense probably benign 0.12
R3864:BC067074 UTSW 13 113322951 missense possibly damaging 0.64
R3971:BC067074 UTSW 13 113317126 missense probably damaging 1.00
R4004:BC067074 UTSW 13 113318380 missense probably benign 0.00
R4271:BC067074 UTSW 13 113342370 missense possibly damaging 0.76
R4382:BC067074 UTSW 13 113322754 missense probably benign 0.10
R4484:BC067074 UTSW 13 113319199 missense probably damaging 0.98
R4570:BC067074 UTSW 13 113318191 missense probably damaging 1.00
R4600:BC067074 UTSW 13 113319249 missense possibly damaging 0.95
R4622:BC067074 UTSW 13 113320081 missense probably benign 0.00
R4676:BC067074 UTSW 13 113368807 missense probably damaging 0.98
R4676:BC067074 UTSW 13 113368808 missense probably damaging 1.00
R4677:BC067074 UTSW 13 113379486 missense unknown
R4775:BC067074 UTSW 13 113317695 missense possibly damaging 0.91
R4779:BC067074 UTSW 13 113368336 missense possibly damaging 0.87
R4780:BC067074 UTSW 13 113317858 missense probably damaging 1.00
R4829:BC067074 UTSW 13 113368162 missense probably benign 0.05
R4841:BC067074 UTSW 13 113366190 missense probably benign 0.00
R4879:BC067074 UTSW 13 113319787 missense probably benign 0.03
R4930:BC067074 UTSW 13 113327662 missense probably damaging 1.00
R4987:BC067074 UTSW 13 113318101 missense probably benign 0.07
R5065:BC067074 UTSW 13 113320919 missense probably benign 0.01
R5216:BC067074 UTSW 13 113342413 missense probably benign 0.20
R5236:BC067074 UTSW 13 113366220 missense probably benign 0.14
R5247:BC067074 UTSW 13 113319459 missense probably damaging 1.00
R5250:BC067074 UTSW 13 113319771 missense possibly damaging 0.95
R5337:BC067074 UTSW 13 113318765 missense probably damaging 1.00
R5342:BC067074 UTSW 13 113366269 critical splice donor site probably null
R5426:BC067074 UTSW 13 113369053 missense probably benign 0.01
R5472:BC067074 UTSW 13 113319169 missense probably benign 0.12
R5526:BC067074 UTSW 13 113367893 missense probably benign 0.22
R5543:BC067074 UTSW 13 113320873 missense probably damaging 0.96
R5589:BC067074 UTSW 13 113317950 missense possibly damaging 0.95
R5623:BC067074 UTSW 13 113346634 missense possibly damaging 0.95
R5668:BC067074 UTSW 13 113317167 missense possibly damaging 0.55
R5793:BC067074 UTSW 13 113321022 missense possibly damaging 0.75
R5824:BC067074 UTSW 13 113368620 missense probably damaging 1.00
R6038:BC067074 UTSW 13 113318619 missense possibly damaging 0.49
R6038:BC067074 UTSW 13 113318619 missense possibly damaging 0.49
R6053:BC067074 UTSW 13 113320726 missense possibly damaging 0.51
R6125:BC067074 UTSW 13 113317683 missense probably benign 0.00
R6129:BC067074 UTSW 13 113368806 nonsense probably null
R6290:BC067074 UTSW 13 113319958 missense probably damaging 0.97
R6291:BC067074 UTSW 13 113320447 missense possibly damaging 0.85
R6302:BC067074 UTSW 13 113368112 missense probably damaging 1.00
R6317:BC067074 UTSW 13 113368268 missense probably benign 0.09
R6395:BC067074 UTSW 13 113369469 missense probably damaging 1.00
R6673:BC067074 UTSW 13 113367832 nonsense probably null
R6783:BC067074 UTSW 13 113320209 nonsense probably null
R6800:BC067074 UTSW 13 113368152 missense probably benign 0.02
R6857:BC067074 UTSW 13 113319958 missense probably damaging 0.97
R6889:BC067074 UTSW 13 113318378 missense probably damaging 0.99
R6934:BC067074 UTSW 13 113369266 missense probably benign
R7019:BC067074 UTSW 13 113351750 missense probably benign 0.01
R7100:BC067074 UTSW 13 113318967 missense
R7115:BC067074 UTSW 13 113320776 missense
R7152:BC067074 UTSW 13 113318850 missense
R7195:BC067074 UTSW 13 113367929 missense
R7213:BC067074 UTSW 13 113317941 missense
R7250:BC067074 UTSW 13 113318815 missense
R7341:BC067074 UTSW 13 113318172 missense
R7358:BC067074 UTSW 13 113319967 missense
R7359:BC067074 UTSW 13 113342430 missense
R7396:BC067074 UTSW 13 113318990 missense
R7632:BC067074 UTSW 13 113320886 missense
R7689:BC067074 UTSW 13 113379414 missense
R7713:BC067074 UTSW 13 113346541 missense
R7892:BC067074 UTSW 13 113319606 missense
R7975:BC067074 UTSW 13 113319307 missense
R8017:BC067074 UTSW 13 113319623 missense
R8019:BC067074 UTSW 13 113319623 missense
R8034:BC067074 UTSW 13 113342511 missense
R8101:BC067074 UTSW 13 113320891 missense
R8104:BC067074 UTSW 13 113319729 missense
R8122:BC067074 UTSW 13 113318908 missense
R8126:BC067074 UTSW 13 113368163 missense
R8272:BC067074 UTSW 13 113368355 missense
Predicted Primers PCR Primer
(F):5'- GAACCTCACAGACCTGCTTCTC -3'
(R):5'- AGTCCTGTTAGCAAGCTCGG -3'

Sequencing Primer
(F):5'- GACCTGCTTCTCCCACAAGG -3'
(R):5'- TAGCAAGCTCGGTTGCATCTAGATC -3'
Posted On2016-04-15