Incidental Mutation 'R4927:Mos'
ID380890
Institutional Source Beutler Lab
Gene Symbol Mos
Ensembl Gene ENSMUSG00000078365
Gene NameMoloney sarcoma oncogene
Synonymsc-mos
MMRRC Submission 042528-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4927 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location3870657-3872105 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3871093 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 241 (T241M)
Ref Sequence ENSEMBL: ENSMUSP00000100789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105158]
Predicted Effect probably damaging
Transcript: ENSMUST00000105158
AA Change: T241M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100789
Gene: ENSMUSG00000078365
AA Change: T241M

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
Pfam:Pkinase_Tyr 63 335 9e-41 PFAM
Pfam:Pkinase 64 334 6.3e-43 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MOS is a serine/threonine kinase that activates the MAP kinase cascade through direct phosphorylation of the MAP kinase activator MEK (MAP2K1; MIM 176872) (Prasad et al., 2008 [PubMed 18246541]).[supplied by OMIM, Jul 2009]
PHENOTYPE: Mutations that inactivate the gene result in female infertility and an increased susceptibility to tumors. Oocytes progress through meiosis II without arrest and undergo spontaneous parthenogenetic activation. Male mice are fertile and show no spermatogenic defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik C T 18: 57,730,816 Q213* probably null Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adamts2 T A 11: 50,803,812 L1142* probably null Het
Arl13b C A 16: 62,801,787 G381V probably damaging Het
Ash1l G T 3: 88,985,334 V1507F probably damaging Het
Babam2 T A 5: 31,702,064 F38I probably benign Het
Bend4 T C 5: 67,400,276 Y399C probably damaging Het
Btn1a1 A T 13: 23,460,624 probably null Het
Cacna1g A T 11: 94,429,147 L1401Q probably damaging Het
Cep192 T C 18: 67,835,124 V893A probably benign Het
Cnot10 A T 9: 114,617,944 Y355N probably damaging Het
Col6a5 G C 9: 105,933,964 S785R unknown Het
Cpa3 A G 3: 20,222,139 L310P probably damaging Het
Cux2 A G 5: 121,877,089 I247T probably benign Het
Dab1 A G 4: 104,704,252 T245A probably benign Het
Dmrta1 A T 4: 89,691,748 D315V probably damaging Het
Dnah12 T A 14: 26,861,805 L599* probably null Het
Dync1h1 T C 12: 110,662,855 I4231T possibly damaging Het
Fat1 T C 8: 45,022,963 V1659A probably damaging Het
Flot2 G A 11: 78,059,062 V406M probably damaging Het
Galnt2 A G 8: 124,305,623 D75G probably damaging Het
Gcnt3 A T 9: 70,035,182 C35S probably damaging Het
Gm13103 A T 4: 143,851,617 Q149L probably damaging Het
Gp2 A G 7: 119,452,895 F199L probably benign Het
Gramd3 C T 18: 56,485,451 P244S probably damaging Het
Hhipl1 T C 12: 108,311,944 L177P probably damaging Het
Homez T C 14: 54,857,807 E148G possibly damaging Het
Kcnab3 G A 11: 69,326,746 C22Y possibly damaging Het
Kcnh8 C A 17: 52,877,981 S430R probably damaging Het
Kcnn2 T C 18: 45,559,731 C125R probably benign Het
Klhl7 G A 5: 24,141,187 R277Q possibly damaging Het
Krt78 A G 15: 101,946,899 S826P probably benign Het
Krtap14 T C 16: 88,826,031 Y20C possibly damaging Het
Lrcol1 A G 5: 110,354,297 probably null Het
Lrrc10b G A 19: 10,456,862 P152S probably damaging Het
Lrrn3 C G 12: 41,453,125 D398H probably damaging Het
Map3k19 T C 1: 127,822,195 I1140V probably benign Het
Nol8 A G 13: 49,654,425 E39G possibly damaging Het
Olfm1 T G 2: 28,214,786 S212A probably benign Het
Olfr319 T A 11: 58,701,807 F35L probably damaging Het
Papd7 A T 13: 69,502,900 probably null Het
Plec G T 15: 76,176,962 T2947K probably damaging Het
Rasgrp3 A G 17: 75,516,355 M474V probably benign Het
Ryr1 T C 7: 29,019,983 Y4333C unknown Het
Scrn2 G C 11: 97,033,500 probably null Het
Slc22a12 C A 19: 6,537,761 V388L probably benign Het
Slc4a11 A G 2: 130,684,946 V754A probably damaging Het
Slco2b1 A G 7: 99,685,988 F195S probably damaging Het
Slfn9 A C 11: 82,981,390 M840R possibly damaging Het
Speer4b T C 5: 27,501,265 N35D probably damaging Het
Taf1d T A 9: 15,309,954 D185E probably damaging Het
Taok2 A G 7: 126,876,041 L245P probably damaging Het
Ticam2 T C 18: 46,560,779 I80M probably damaging Het
Tmem268 G A 4: 63,583,927 V331I probably benign Het
Tmem55a G T 4: 14,912,458 R189L probably damaging Het
Tsga10 T C 1: 37,801,850 E425G probably damaging Het
Ttc7 A G 17: 87,346,705 probably null Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Unc13a T C 8: 71,654,845 H601R probably damaging Het
Vmn2r102 A T 17: 19,660,399 M1L probably benign Het
Vmn2r120 G T 17: 57,509,125 N743K probably damaging Het
Wnt6 C A 1: 74,784,136 probably null Het
Wnt6 A C 1: 74,784,137 probably null Het
Wnt8a T A 18: 34,547,472 C297S probably damaging Het
Zfp786 T C 6: 47,820,153 Q617R probably benign Het
Zfp91 A G 19: 12,776,410 probably null Het
Zw10 T A 9: 49,068,683 F371L probably damaging Het
Other mutations in Mos
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Mos APN 4 3871459 missense probably damaging 1.00
IGL01302:Mos APN 4 3871815 utr 5 prime probably benign
IGL01739:Mos APN 4 3871816 utr 5 prime probably benign
IGL01867:Mos APN 4 3870845 missense probably benign 0.33
IGL02647:Mos APN 4 3870961 missense probably damaging 1.00
PIT4418001:Mos UTSW 4 3870814 missense possibly damaging 0.86
R0967:Mos UTSW 4 3870932 missense probably benign
R5729:Mos UTSW 4 3870971 missense probably benign 0.01
R6947:Mos UTSW 4 3871585 missense probably damaging 1.00
R8359:Mos UTSW 4 3871097 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTTCTGCAGTGTCTTTCCAG -3'
(R):5'- CTAGATGTTGTTAACGGCCTGC -3'

Sequencing Primer
(F):5'- TCTTTCCAGTCAGGGAGGC -3'
(R):5'- AGATGTTGTTAACGGCCTGCTTTTTC -3'
Posted On2016-04-15