Incidental Mutation 'R4927:Cux2'
ID380902
Institutional Source Beutler Lab
Gene Symbol Cux2
Ensembl Gene ENSMUSG00000042589
Gene Namecut-like homeobox 2
SynonymsCutl2, Cux-2, ENSMUSG00000072641, 1700051K22Rik, Cux2
MMRRC Submission 042528-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.425) question?
Stock #R4927 (G1)
Quality Score174
Status Validated
Chromosome5
Chromosomal Location121856366-122050102 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121877089 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 247 (I247T)
Ref Sequence ENSEMBL: ENSMUSP00000130302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086317] [ENSMUST00000111752] [ENSMUST00000168288]
Predicted Effect probably benign
Transcript: ENSMUST00000086317
AA Change: I247T

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000083497
Gene: ENSMUSG00000042589
AA Change: I247T

DomainStartEndE-ValueType
coiled coil region 133 214 N/A INTRINSIC
coiled coil region 235 311 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
CUT 484 569 7.62e-34 SMART
coiled coil region 626 655 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 740 757 N/A INTRINSIC
CUT 829 917 6.52e-42 SMART
low complexity region 965 976 N/A INTRINSIC
CUT 984 1070 1.12e-40 SMART
HOX 1113 1175 7.54e-13 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111752
AA Change: I247T

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107381
Gene: ENSMUSG00000042589
AA Change: I247T

DomainStartEndE-ValueType
coiled coil region 133 214 N/A INTRINSIC
coiled coil region 235 311 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
CUT 484 569 7.62e-34 SMART
coiled coil region 626 655 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 740 757 N/A INTRINSIC
CUT 829 917 6.52e-42 SMART
low complexity region 965 976 N/A INTRINSIC
CUT 984 1070 1.12e-40 SMART
HOX 1113 1175 7.54e-13 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156942
SMART Domains Protein: ENSMUSP00000114239
Gene: ENSMUSG00000042589

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
CUT 50 135 7.62e-34 SMART
low complexity region 152 162 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168288
AA Change: I247T

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130302
Gene: ENSMUSG00000042589
AA Change: I247T

DomainStartEndE-ValueType
coiled coil region 133 214 N/A INTRINSIC
coiled coil region 235 311 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
CUT 484 569 7.62e-34 SMART
coiled coil region 626 655 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 740 757 N/A INTRINSIC
CUT 829 917 6.52e-42 SMART
low complexity region 965 976 N/A INTRINSIC
CUT 984 1070 1.12e-40 SMART
HOX 1113 1175 7.54e-13 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: This gene is a member of the Cut family of transcription factors that have multiple DNA binding domains and regulate cell proliferation and differentiation. This gene is primarily expressed in nervous tissues where it controls the proliferation of neuronal precursors, and may play a role in organogenesis earlier during embryonic development. Mice lacking the encoded protein exhibit smaller spinal cords with deficits in neural progenitor development as well as in neuroblast and interneuron differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit various neural defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik C T 18: 57,730,816 Q213* probably null Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adamts2 T A 11: 50,803,812 L1142* probably null Het
Arl13b C A 16: 62,801,787 G381V probably damaging Het
Ash1l G T 3: 88,985,334 V1507F probably damaging Het
Babam2 T A 5: 31,702,064 F38I probably benign Het
Bend4 T C 5: 67,400,276 Y399C probably damaging Het
Btn1a1 A T 13: 23,460,624 probably null Het
Cacna1g A T 11: 94,429,147 L1401Q probably damaging Het
Cep192 T C 18: 67,835,124 V893A probably benign Het
Cnot10 A T 9: 114,617,944 Y355N probably damaging Het
Col6a5 G C 9: 105,933,964 S785R unknown Het
Cpa3 A G 3: 20,222,139 L310P probably damaging Het
Dab1 A G 4: 104,704,252 T245A probably benign Het
Dmrta1 A T 4: 89,691,748 D315V probably damaging Het
Dnah12 T A 14: 26,861,805 L599* probably null Het
Dync1h1 T C 12: 110,662,855 I4231T possibly damaging Het
Fat1 T C 8: 45,022,963 V1659A probably damaging Het
Flot2 G A 11: 78,059,062 V406M probably damaging Het
Galnt2 A G 8: 124,305,623 D75G probably damaging Het
Gcnt3 A T 9: 70,035,182 C35S probably damaging Het
Gm13103 A T 4: 143,851,617 Q149L probably damaging Het
Gp2 A G 7: 119,452,895 F199L probably benign Het
Gramd3 C T 18: 56,485,451 P244S probably damaging Het
Hhipl1 T C 12: 108,311,944 L177P probably damaging Het
Homez T C 14: 54,857,807 E148G possibly damaging Het
Kcnab3 G A 11: 69,326,746 C22Y possibly damaging Het
Kcnh8 C A 17: 52,877,981 S430R probably damaging Het
Kcnn2 T C 18: 45,559,731 C125R probably benign Het
Klhl7 G A 5: 24,141,187 R277Q possibly damaging Het
Krt78 A G 15: 101,946,899 S826P probably benign Het
Krtap14 T C 16: 88,826,031 Y20C possibly damaging Het
Lrcol1 A G 5: 110,354,297 probably null Het
Lrrc10b G A 19: 10,456,862 P152S probably damaging Het
Lrrn3 C G 12: 41,453,125 D398H probably damaging Het
Map3k19 T C 1: 127,822,195 I1140V probably benign Het
Mos G A 4: 3,871,093 T241M probably damaging Het
Nol8 A G 13: 49,654,425 E39G possibly damaging Het
Olfm1 T G 2: 28,214,786 S212A probably benign Het
Olfr319 T A 11: 58,701,807 F35L probably damaging Het
Papd7 A T 13: 69,502,900 probably null Het
Plec G T 15: 76,176,962 T2947K probably damaging Het
Rasgrp3 A G 17: 75,516,355 M474V probably benign Het
Ryr1 T C 7: 29,019,983 Y4333C unknown Het
Scrn2 G C 11: 97,033,500 probably null Het
Slc22a12 C A 19: 6,537,761 V388L probably benign Het
Slc4a11 A G 2: 130,684,946 V754A probably damaging Het
Slco2b1 A G 7: 99,685,988 F195S probably damaging Het
Slfn9 A C 11: 82,981,390 M840R possibly damaging Het
Speer4b T C 5: 27,501,265 N35D probably damaging Het
Taf1d T A 9: 15,309,954 D185E probably damaging Het
Taok2 A G 7: 126,876,041 L245P probably damaging Het
Ticam2 T C 18: 46,560,779 I80M probably damaging Het
Tmem268 G A 4: 63,583,927 V331I probably benign Het
Tmem55a G T 4: 14,912,458 R189L probably damaging Het
Tsga10 T C 1: 37,801,850 E425G probably damaging Het
Ttc7 A G 17: 87,346,705 probably null Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Unc13a T C 8: 71,654,845 H601R probably damaging Het
Vmn2r102 A T 17: 19,660,399 M1L probably benign Het
Vmn2r120 G T 17: 57,509,125 N743K probably damaging Het
Wnt6 C A 1: 74,784,136 probably null Het
Wnt6 A C 1: 74,784,137 probably null Het
Wnt8a T A 18: 34,547,472 C297S probably damaging Het
Zfp786 T C 6: 47,820,153 Q617R probably benign Het
Zfp91 A G 19: 12,776,410 probably null Het
Zw10 T A 9: 49,068,683 F371L probably damaging Het
Other mutations in Cux2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Cux2 APN 5 121868538 missense possibly damaging 0.92
IGL00917:Cux2 APN 5 121869105 missense probably null 0.05
IGL00979:Cux2 APN 5 121873714 missense probably damaging 0.98
IGL01069:Cux2 APN 5 121867351 missense possibly damaging 0.84
IGL01303:Cux2 APN 5 121865928 missense probably benign 0.03
IGL01583:Cux2 APN 5 121874107 missense probably damaging 0.98
IGL01762:Cux2 APN 5 121873145 missense probably damaging 1.00
IGL02508:Cux2 APN 5 121860822 missense possibly damaging 0.93
R0333:Cux2 UTSW 5 121860608 missense probably benign 0.04
R0352:Cux2 UTSW 5 121884739 splice site probably benign
R0443:Cux2 UTSW 5 121887437 missense possibly damaging 0.66
R1853:Cux2 UTSW 5 121869121 missense possibly damaging 0.95
R2011:Cux2 UTSW 5 121861326 missense probably benign 0.21
R2057:Cux2 UTSW 5 121869504 missense probably benign 0.02
R2165:Cux2 UTSW 5 121887477 missense possibly damaging 0.78
R3964:Cux2 UTSW 5 121887476 nonsense probably null
R4182:Cux2 UTSW 5 121868492 missense probably damaging 1.00
R4579:Cux2 UTSW 5 121860653 missense probably benign 0.01
R4655:Cux2 UTSW 5 121885934 missense possibly damaging 0.95
R4673:Cux2 UTSW 5 121887476 nonsense probably null
R4697:Cux2 UTSW 5 121873753 missense probably damaging 1.00
R5348:Cux2 UTSW 5 121865978 missense probably damaging 0.99
R6208:Cux2 UTSW 5 121860822 missense possibly damaging 0.93
R6500:Cux2 UTSW 5 121864726 missense probably benign 0.03
R6661:Cux2 UTSW 5 121869297 missense probably benign 0.04
R6986:Cux2 UTSW 5 121868579 missense possibly damaging 0.84
R7296:Cux2 UTSW 5 121861256 missense probably benign 0.25
R7561:Cux2 UTSW 5 121879868 missense probably benign 0.31
X0027:Cux2 UTSW 5 121884751 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AAGGATCTAATGAAGCTGGCCC -3'
(R):5'- ACGGCTTCTGTAAGGGGAAC -3'

Sequencing Primer
(F):5'- ATGAAGCTGGCCCGTGCTC -3'
(R):5'- CAGTGTCAGATCGCCAGATG -3'
Posted On2016-04-15