Mutagenetix > Incidental Mutation

Incidental Mutation 'R4927:Lrrn3'

380924

Institutional Source

Beutler Lab

Gene Symbol

Lrrn3

Ensembl Gene

ENSMUSG00000036295

Gene Name

leucine rich repeat protein 3, neuronal

Synonyms

NLRR-3

MMRRC Submission

042528-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.211) question?

Stock #

R4927 (G1)

Quality Score

125

Status

Validated

Chromosome

Chromosomal Location

41451668-41486431 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 41453125 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Histidine at position 398 (D398H)

Ref Sequence

ENSEMBL: ENSMUSP00000043818 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043884] [ENSMUST00000132121] [ENSMUST00000134965]

AlphaFold

Q8CBC6

Predicted Effect

probably damaging
Transcript: ENSMUST00000043884
AA Change: D398H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043818
Gene: ENSMUSG00000036295
AA Change: D398H

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
LRRNT	28	73	9.17e-4	SMART
LRR	115	138	2.63e0	SMART
LRR_TYP	139	162	1.5e-4	SMART
LRR	163	186	7.55e-1	SMART
LRR	187	210	1.76e1	SMART
LRR	211	234	1.62e1	SMART
LRR	235	258	5.11e0	SMART
LRR	260	282	3.18e1	SMART
LRR	333	356	4.44e0	SMART
LRRCT	368	420	3.7e-5	SMART
IGc2	435	503	5.04e-9	SMART
FN3	521	602	3.49e0	SMART
transmembrane domain	626	648	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132121

SMART Domains

Protein: ENSMUSP00000118779
Gene: ENSMUSG00000056899

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S24	38	115	7.7e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000134965

SMART Domains

Protein: ENSMUSP00000116441
Gene: ENSMUSG00000056899

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S24	38	114	6.4e-11	PFAM

Meta Mutation Damage Score

0.1370

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

97% (76/78)

MGI Phenotype

PHENOTYPE: Homozygous null mutant mice exhibited increased mean percent body fat and male homozygous mutant mice exhibited enhanced glucose tolerance when compared with controls. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011I03Rik	C	T	18: 57,730,816	Q213*	probably null	Het
Ablim2	C	T	5: 35,802,422	R73C	possibly damaging	Het
Adamts2	T	A	11: 50,803,812	L1142*	probably null	Het
Arl13b	C	A	16: 62,801,787	G381V	probably damaging	Het
Ash1l	G	T	3: 88,985,334	V1507F	probably damaging	Het
Babam2	T	A	5: 31,702,064	F38I	probably benign	Het
Bend4	T	C	5: 67,400,276	Y399C	probably damaging	Het
Btn1a1	A	T	13: 23,460,624		probably null	Het
Cacna1g	A	T	11: 94,429,147	L1401Q	probably damaging	Het
Cep192	T	C	18: 67,835,124	V893A	probably benign	Het
Cnot10	A	T	9: 114,617,944	Y355N	probably damaging	Het
Col6a5	G	C	9: 105,933,964	S785R	unknown	Het
Cpa3	A	G	3: 20,222,139	L310P	probably damaging	Het
Cux2	A	G	5: 121,877,089	I247T	probably benign	Het
Dab1	A	G	4: 104,704,252	T245A	probably benign	Het
Dmrta1	A	T	4: 89,691,748	D315V	probably damaging	Het
Dnah12	T	A	14: 26,861,805	L599*	probably null	Het
Dync1h1	T	C	12: 110,662,855	I4231T	possibly damaging	Het
Fat1	T	C	8: 45,022,963	V1659A	probably damaging	Het
Flot2	G	A	11: 78,059,062	V406M	probably damaging	Het
Galnt2	A	G	8: 124,305,623	D75G	probably damaging	Het
Gcnt3	A	T	9: 70,035,182	C35S	probably damaging	Het
Gm13103	A	T	4: 143,851,617	Q149L	probably damaging	Het
Gp2	A	G	7: 119,452,895	F199L	probably benign	Het
Gramd3	C	T	18: 56,485,451	P244S	probably damaging	Het
Hhipl1	T	C	12: 108,311,944	L177P	probably damaging	Het
Homez	T	C	14: 54,857,807	E148G	possibly damaging	Het
Kcnab3	G	A	11: 69,326,746	C22Y	possibly damaging	Het
Kcnh8	C	A	17: 52,877,981	S430R	probably damaging	Het
Kcnn2	T	C	18: 45,559,731	C125R	probably benign	Het
Klhl7	G	A	5: 24,141,187	R277Q	possibly damaging	Het
Krt78	A	G	15: 101,946,899	S826P	probably benign	Het
Krtap14	T	C	16: 88,826,031	Y20C	possibly damaging	Het
Lrcol1	A	G	5: 110,354,297		probably null	Het
Lrrc10b	G	A	19: 10,456,862	P152S	probably damaging	Het
Map3k19	T	C	1: 127,822,195	I1140V	probably benign	Het
Mos	G	A	4: 3,871,093	T241M	probably damaging	Het
Nol8	A	G	13: 49,654,425	E39G	possibly damaging	Het
Olfm1	T	G	2: 28,214,786	S212A	probably benign	Het
Olfr319	T	A	11: 58,701,807	F35L	probably damaging	Het
Papd7	A	T	13: 69,502,900		probably null	Het
Plec	G	T	15: 76,176,962	T2947K	probably damaging	Het
Rasgrp3	A	G	17: 75,516,355	M474V	probably benign	Het
Ryr1	T	C	7: 29,019,983	Y4333C	unknown	Het
Scrn2	G	C	11: 97,033,500		probably null	Het
Slc22a12	C	A	19: 6,537,761	V388L	probably benign	Het
Slc4a11	A	G	2: 130,684,946	V754A	probably damaging	Het
Slco2b1	A	G	7: 99,685,988	F195S	probably damaging	Het
Slfn9	A	C	11: 82,981,390	M840R	possibly damaging	Het
Speer4b	T	C	5: 27,501,265	N35D	probably damaging	Het
Taf1d	T	A	9: 15,309,954	D185E	probably damaging	Het
Taok2	A	G	7: 126,876,041	L245P	probably damaging	Het
Ticam2	T	C	18: 46,560,779	I80M	probably damaging	Het
Tmem268	G	A	4: 63,583,927	V331I	probably benign	Het
Tmem55a	G	T	4: 14,912,458	R189L	probably damaging	Het
Tsga10	T	C	1: 37,801,850	E425G	probably damaging	Het
Ttc7	A	G	17: 87,346,705		probably null	Het
Ttf1	C	T	2: 29,064,656	H11Y	possibly damaging	Het
Unc13a	T	C	8: 71,654,845	H601R	probably damaging	Het
Vmn2r102	A	T	17: 19,660,399	M1L	probably benign	Het
Vmn2r120	G	T	17: 57,509,125	N743K	probably damaging	Het
Wnt6	C	A	1: 74,784,136		probably null	Het
Wnt6	A	C	1: 74,784,137		probably null	Het
Wnt8a	T	A	18: 34,547,472	C297S	probably damaging	Het
Zfp786	T	C	6: 47,820,153	Q617R	probably benign	Het
Zfp91	A	G	19: 12,776,410		probably null	Het
Zw10	T	A	9: 49,068,683	F371L	probably damaging	Het

Other mutations in Lrrn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Lrrn3	APN	12	41452192	intron	probably benign
IGL02825:Lrrn3	APN	12	41452593	missense	probably damaging	1.00
IGL02927:Lrrn3	APN	12	41453344	missense	probably damaging	1.00
IGL02970:Lrrn3	APN	12	41452360	missense	probably benign
IGL02995:Lrrn3	APN	12	41452217	missense	probably damaging	1.00
IGL02999:Lrrn3	APN	12	41452751	missense	probably benign	0.01
IGL03182:Lrrn3	APN	12	41454021	missense	probably damaging	1.00
IGL03280:Lrrn3	APN	12	41454147	missense	probably damaging	0.97
PIT4469001:Lrrn3	UTSW	12	41453018	missense	probably benign	0.03
R0167:Lrrn3	UTSW	12	41454015	missense	probably damaging	1.00
R0414:Lrrn3	UTSW	12	41453940	missense	probably damaging	1.00
R0787:Lrrn3	UTSW	12	41454231	missense	probably damaging	1.00
R0894:Lrrn3	UTSW	12	41454034	missense	probably damaging	1.00
R1433:Lrrn3	UTSW	12	41452584	missense	possibly damaging	0.74
R1610:Lrrn3	UTSW	12	41452993	missense	possibly damaging	0.89
R1834:Lrrn3	UTSW	12	41453518	missense	probably damaging	1.00
R2068:Lrrn3	UTSW	12	41452996	missense	probably damaging	1.00
R2871:Lrrn3	UTSW	12	41452723	missense	probably benign	0.00
R2871:Lrrn3	UTSW	12	41452723	missense	probably benign	0.00
R3771:Lrrn3	UTSW	12	41452870	missense	probably damaging	1.00
R4408:Lrrn3	UTSW	12	41454042	missense	probably benign	0.04
R4410:Lrrn3	UTSW	12	41452584	missense	possibly damaging	0.74
R4684:Lrrn3	UTSW	12	41454244	missense	possibly damaging	0.75
R4770:Lrrn3	UTSW	12	41452443	missense	probably benign	0.08
R5037:Lrrn3	UTSW	12	41453595	missense	probably damaging	1.00
R5482:Lrrn3	UTSW	12	41452387	missense	probably benign	0.01
R5482:Lrrn3	UTSW	12	41452388	missense	probably damaging	0.96
R5667:Lrrn3	UTSW	12	41452298	missense	possibly damaging	0.77
R6022:Lrrn3	UTSW	12	41453430	missense	probably damaging	0.96
R6087:Lrrn3	UTSW	12	41453535	missense	possibly damaging	0.84
R6129:Lrrn3	UTSW	12	41453788	nonsense	probably null
R6309:Lrrn3	UTSW	12	41453206	missense	probably damaging	1.00
R7449:Lrrn3	UTSW	12	41453488	missense	probably damaging	1.00
R7555:Lrrn3	UTSW	12	41452911	missense	probably benign	0.01
R7560:Lrrn3	UTSW	12	41452713	missense	possibly damaging	0.93
R8059:Lrrn3	UTSW	12	41454217	missense	probably benign	0.22
R8134:Lrrn3	UTSW	12	41453048	missense	probably damaging	1.00
R8798:Lrrn3	UTSW	12	41453175	missense	possibly damaging	0.61
R9308:Lrrn3	UTSW	12	41453946	missense	probably damaging	1.00
R9318:Lrrn3	UTSW	12	41453244	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTAGTGTGCCTTCAGAATGAAC -3'
(R):5'- TCTCATGCTGAACACCAACG -3'

Sequencing Primer
(F):5'- CCAGAAGGTGTGATCCAGTAGATTTC -3'
(R):5'- AACGCCCTCAGTGCCCTC -3'

Posted On

2016-04-15