Incidental Mutation 'R4927:Rasgrp3'
ID380940
Institutional Source Beutler Lab
Gene Symbol Rasgrp3
Ensembl Gene ENSMUSG00000071042
Gene NameRAS, guanyl releasing protein 3
SynonymsLOC240168
MMRRC Submission 042528-MU
Accession Numbers

Ncbi RefSeq: NM_207246.4, NM_001166493.1; MGI:3028579

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4927 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location75435905-75529043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75516355 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 474 (M474V)
Ref Sequence ENSEMBL: ENSMUSP00000129393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095204] [ENSMUST00000164192]
Predicted Effect probably benign
Transcript: ENSMUST00000095204
AA Change: M474V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000092828
Gene: ENSMUSG00000071042
AA Change: M474V

DomainStartEndE-ValueType
RasGEFN 2 125 6.77e-12 SMART
RasGEF 148 384 4.57e-104 SMART
EFh 424 452 1.07e-1 SMART
EFh 453 481 4.04e0 SMART
C1 495 544 5.47e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164192
AA Change: M474V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000129393
Gene: ENSMUSG00000071042
AA Change: M474V

DomainStartEndE-ValueType
RasGEFN 2 125 6.77e-12 SMART
RasGEF 148 384 4.57e-104 SMART
EFh 424 452 1.07e-1 SMART
EFh 453 481 4.04e0 SMART
C1 495 544 5.47e-17 SMART
Meta Mutation Damage Score 0.0803 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 97% (76/78)
MGI Phenotype Strain: 3625862; 3525522
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RASGRP3, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile with no obvious abnormalities in the kidneys or vasculature. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik C T 18: 57,730,816 Q213* probably null Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adamts2 T A 11: 50,803,812 L1142* probably null Het
Arl13b C A 16: 62,801,787 G381V probably damaging Het
Ash1l G T 3: 88,985,334 V1507F probably damaging Het
Babam2 T A 5: 31,702,064 F38I probably benign Het
Bend4 T C 5: 67,400,276 Y399C probably damaging Het
Btn1a1 A T 13: 23,460,624 probably null Het
Cacna1g A T 11: 94,429,147 L1401Q probably damaging Het
Cep192 T C 18: 67,835,124 V893A probably benign Het
Cnot10 A T 9: 114,617,944 Y355N probably damaging Het
Col6a5 G C 9: 105,933,964 S785R unknown Het
Cpa3 A G 3: 20,222,139 L310P probably damaging Het
Cux2 A G 5: 121,877,089 I247T probably benign Het
Dab1 A G 4: 104,704,252 T245A probably benign Het
Dmrta1 A T 4: 89,691,748 D315V probably damaging Het
Dnah12 T A 14: 26,861,805 L599* probably null Het
Dync1h1 T C 12: 110,662,855 I4231T possibly damaging Het
Fat1 T C 8: 45,022,963 V1659A probably damaging Het
Flot2 G A 11: 78,059,062 V406M probably damaging Het
Galnt2 A G 8: 124,305,623 D75G probably damaging Het
Gcnt3 A T 9: 70,035,182 C35S probably damaging Het
Gm13103 A T 4: 143,851,617 Q149L probably damaging Het
Gp2 A G 7: 119,452,895 F199L probably benign Het
Gramd3 C T 18: 56,485,451 P244S probably damaging Het
Hhipl1 T C 12: 108,311,944 L177P probably damaging Het
Homez T C 14: 54,857,807 E148G possibly damaging Het
Kcnab3 G A 11: 69,326,746 C22Y possibly damaging Het
Kcnh8 C A 17: 52,877,981 S430R probably damaging Het
Kcnn2 T C 18: 45,559,731 C125R probably benign Het
Klhl7 G A 5: 24,141,187 R277Q possibly damaging Het
Krt78 A G 15: 101,946,899 S826P probably benign Het
Krtap14 T C 16: 88,826,031 Y20C possibly damaging Het
Lrcol1 A G 5: 110,354,297 probably null Het
Lrrc10b G A 19: 10,456,862 P152S probably damaging Het
Lrrn3 C G 12: 41,453,125 D398H probably damaging Het
Map3k19 T C 1: 127,822,195 I1140V probably benign Het
Mos G A 4: 3,871,093 T241M probably damaging Het
Nol8 A G 13: 49,654,425 E39G possibly damaging Het
Olfm1 T G 2: 28,214,786 S212A probably benign Het
Olfr319 T A 11: 58,701,807 F35L probably damaging Het
Papd7 A T 13: 69,502,900 probably null Het
Plec G T 15: 76,176,962 T2947K probably damaging Het
Ryr1 T C 7: 29,019,983 Y4333C unknown Het
Scrn2 G C 11: 97,033,500 probably null Het
Slc22a12 C A 19: 6,537,761 V388L probably benign Het
Slc4a11 A G 2: 130,684,946 V754A probably damaging Het
Slco2b1 A G 7: 99,685,988 F195S probably damaging Het
Slfn9 A C 11: 82,981,390 M840R possibly damaging Het
Speer4b T C 5: 27,501,265 N35D probably damaging Het
Taf1d T A 9: 15,309,954 D185E probably damaging Het
Taok2 A G 7: 126,876,041 L245P probably damaging Het
Ticam2 T C 18: 46,560,779 I80M probably damaging Het
Tmem268 G A 4: 63,583,927 V331I probably benign Het
Tmem55a G T 4: 14,912,458 R189L probably damaging Het
Tsga10 T C 1: 37,801,850 E425G probably damaging Het
Ttc7 A G 17: 87,346,705 probably null Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Unc13a T C 8: 71,654,845 H601R probably damaging Het
Vmn2r102 A T 17: 19,660,399 M1L probably benign Het
Vmn2r120 G T 17: 57,509,125 N743K probably damaging Het
Wnt6 C A 1: 74,784,136 probably null Het
Wnt6 A C 1: 74,784,137 probably null Het
Wnt8a T A 18: 34,547,472 C297S probably damaging Het
Zfp786 T C 6: 47,820,153 Q617R probably benign Het
Zfp91 A G 19: 12,776,410 probably null Het
Zw10 T A 9: 49,068,683 F371L probably damaging Het
Other mutations in Rasgrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02270:Rasgrp3 APN 17 75516373 missense probably benign 0.00
IGL02529:Rasgrp3 APN 17 75525102 missense possibly damaging 0.84
IGL02672:Rasgrp3 APN 17 75496417 missense probably benign 0.00
IGL02935:Rasgrp3 APN 17 75497070 missense probably benign 0.00
Aster UTSW 17 75509827 splice site probably null
aston UTSW 17 75500758 critical splice donor site probably null
centre UTSW 17 75500734 missense possibly damaging 0.50
P0021:Rasgrp3 UTSW 17 75500713 missense probably damaging 1.00
PIT4243001:Rasgrp3 UTSW 17 75500139 missense probably damaging 1.00
R0090:Rasgrp3 UTSW 17 75498461 missense probably damaging 1.00
R0907:Rasgrp3 UTSW 17 75509827 splice site probably null
R1182:Rasgrp3 UTSW 17 75503190 missense probably benign 0.01
R1412:Rasgrp3 UTSW 17 75509827 splice site probably null
R1572:Rasgrp3 UTSW 17 75500734 missense possibly damaging 0.50
R1664:Rasgrp3 UTSW 17 75524177 missense probably damaging 1.00
R2094:Rasgrp3 UTSW 17 75503141 missense probably damaging 1.00
R2111:Rasgrp3 UTSW 17 75500758 critical splice donor site probably null
R3026:Rasgrp3 UTSW 17 75524921 missense possibly damaging 0.52
R4052:Rasgrp3 UTSW 17 75496968 missense probably damaging 1.00
R4348:Rasgrp3 UTSW 17 75511980 missense probably benign 0.00
R4509:Rasgrp3 UTSW 17 75500673 missense probably damaging 1.00
R4642:Rasgrp3 UTSW 17 75498448 missense possibly damaging 0.64
R4791:Rasgrp3 UTSW 17 75500173 missense probably benign 0.37
R4901:Rasgrp3 UTSW 17 75514116 nonsense probably null
R5410:Rasgrp3 UTSW 17 75497047 missense probably benign 0.01
R5444:Rasgrp3 UTSW 17 75503375 missense probably damaging 0.99
R5483:Rasgrp3 UTSW 17 75525018 missense probably damaging 1.00
R5518:Rasgrp3 UTSW 17 75516359 missense probably benign 0.36
R5755:Rasgrp3 UTSW 17 75524945 missense probably benign 0.44
R5845:Rasgrp3 UTSW 17 75503147 missense possibly damaging 0.61
R6310:Rasgrp3 UTSW 17 75494209 missense probably damaging 1.00
R6604:Rasgrp3 UTSW 17 75503115 missense probably benign 0.10
R6826:Rasgrp3 UTSW 17 75503246 missense probably damaging 1.00
R7409:Rasgrp3 UTSW 17 75516416 missense possibly damaging 0.48
R7507:Rasgrp3 UTSW 17 75497060 missense probably damaging 1.00
R7536:Rasgrp3 UTSW 17 75514133 missense probably damaging 1.00
R7538:Rasgrp3 UTSW 17 75496416 missense probably benign
X0011:Rasgrp3 UTSW 17 75525166 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTATTGGGGAAGGCTTTGAC -3'
(R):5'- GTCTCAGGGAGCAATCACAC -3'

Sequencing Primer
(F):5'- AAGGCTTTGACTATGTTGTGCTC -3'
(R):5'- GGAGCAATCACACAACCGATTTTTG -3'
Posted On2016-04-15