Incidental Mutation 'R4927:Slc22a12'
ID380948
Institutional Source Beutler Lab
Gene Symbol Slc22a12
Ensembl Gene ENSMUSG00000061742
Gene Namesolute carrier family 22 (organic anion/cation transporter), member 12
SynonymsRst, URAT1
MMRRC Submission 042528-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4927 (G1)
Quality Score218
Status Validated
Chromosome19
Chromosomal Location6535845-6543019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 6537761 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 388 (V388L)
Ref Sequence ENSEMBL: ENSMUSP00000109078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077182] [ENSMUST00000113451] [ENSMUST00000113458] [ENSMUST00000113459] [ENSMUST00000113462] [ENSMUST00000137166]
Predicted Effect probably benign
Transcript: ENSMUST00000077182
SMART Domains Protein: ENSMUSP00000076424
Gene: ENSMUSG00000033768

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
low complexity region 268 276 N/A INTRINSIC
LamG 310 444 1.18e-33 SMART
LamG 498 651 1.51e-40 SMART
EGF 678 712 8.91e-3 SMART
LamG 737 875 4.91e-22 SMART
LamG 923 1059 1.08e-41 SMART
EGF 1084 1118 1.91e1 SMART
LamG 1146 1303 4.48e-16 SMART
low complexity region 1332 1362 N/A INTRINSIC
low complexity region 1430 1445 N/A INTRINSIC
4.1m 1448 1466 3.75e-4 SMART
low complexity region 1480 1499 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113451
AA Change: V388L

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109078
Gene: ENSMUSG00000061742
AA Change: V388L

DomainStartEndE-ValueType
Pfam:Sugar_tr 95 525 2e-26 PFAM
Pfam:MFS_1 128 484 7.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113458
SMART Domains Protein: ENSMUSP00000109085
Gene: ENSMUSG00000033768

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
LamG 111 268 4.48e-16 SMART
low complexity region 297 327 N/A INTRINSIC
low complexity region 383 404 N/A INTRINSIC
low complexity region 587 602 N/A INTRINSIC
4.1m 605 623 3.75e-4 SMART
low complexity region 637 656 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113459
SMART Domains Protein: ENSMUSP00000109086
Gene: ENSMUSG00000033768

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
LamG 111 238 1.26e-19 SMART
low complexity region 267 297 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113462
SMART Domains Protein: ENSMUSP00000109089
Gene: ENSMUSG00000033768

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
low complexity region 268 276 N/A INTRINSIC
LamG 310 452 8.4e-30 SMART
LamG 506 659 1.51e-40 SMART
EGF 686 720 8.91e-3 SMART
LamG 745 883 4.91e-22 SMART
LamG 931 1067 1.08e-41 SMART
EGF 1092 1126 1.91e1 SMART
LamG 1154 1311 4.48e-16 SMART
low complexity region 1340 1370 N/A INTRINSIC
low complexity region 1426 1447 N/A INTRINSIC
low complexity region 1630 1645 N/A INTRINSIC
4.1m 1648 1666 3.75e-4 SMART
low complexity region 1680 1699 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000126142
AA Change: V266L
SMART Domains Protein: ENSMUSP00000114626
Gene: ENSMUSG00000061742
AA Change: V266L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 229 248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129698
Predicted Effect probably benign
Transcript: ENSMUST00000137166
SMART Domains Protein: ENSMUSP00000119762
Gene: ENSMUSG00000033768

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
low complexity region 268 276 N/A INTRINSIC
LamG 310 459 8.87e-29 SMART
LamG 513 666 1.51e-40 SMART
EGF 693 727 8.91e-3 SMART
LamG 752 890 4.91e-22 SMART
LamG 938 1074 1.08e-41 SMART
EGF 1099 1133 1.91e1 SMART
LamG 1161 1318 4.48e-16 SMART
low complexity region 1347 1377 N/A INTRINSIC
low complexity region 1433 1454 N/A INTRINSIC
low complexity region 1637 1652 N/A INTRINSIC
4.1m 1655 1673 3.75e-4 SMART
low complexity region 1687 1706 N/A INTRINSIC
Meta Mutation Damage Score 0.2396 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the organic anion transporter (OAT) family, and it acts as a urate transporter to regulate urate levels in blood. This protein is an integral membrane protein primarily found in epithelial cells of the proximal tubule of the kidney. An elevated level of serum urate, hyperuricemia, is associated with increased incidences of gout, and mutations in this gene cause renal hypouricemia type 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit increased urinary urate levels and altered urine and plasma metabolite composition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik C T 18: 57,730,816 Q213* probably null Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adamts2 T A 11: 50,803,812 L1142* probably null Het
Arl13b C A 16: 62,801,787 G381V probably damaging Het
Ash1l G T 3: 88,985,334 V1507F probably damaging Het
Babam2 T A 5: 31,702,064 F38I probably benign Het
Bend4 T C 5: 67,400,276 Y399C probably damaging Het
Btn1a1 A T 13: 23,460,624 probably null Het
Cacna1g A T 11: 94,429,147 L1401Q probably damaging Het
Cep192 T C 18: 67,835,124 V893A probably benign Het
Cnot10 A T 9: 114,617,944 Y355N probably damaging Het
Col6a5 G C 9: 105,933,964 S785R unknown Het
Cpa3 A G 3: 20,222,139 L310P probably damaging Het
Cux2 A G 5: 121,877,089 I247T probably benign Het
Dab1 A G 4: 104,704,252 T245A probably benign Het
Dmrta1 A T 4: 89,691,748 D315V probably damaging Het
Dnah12 T A 14: 26,861,805 L599* probably null Het
Dync1h1 T C 12: 110,662,855 I4231T possibly damaging Het
Fat1 T C 8: 45,022,963 V1659A probably damaging Het
Flot2 G A 11: 78,059,062 V406M probably damaging Het
Galnt2 A G 8: 124,305,623 D75G probably damaging Het
Gcnt3 A T 9: 70,035,182 C35S probably damaging Het
Gm13103 A T 4: 143,851,617 Q149L probably damaging Het
Gp2 A G 7: 119,452,895 F199L probably benign Het
Gramd3 C T 18: 56,485,451 P244S probably damaging Het
Hhipl1 T C 12: 108,311,944 L177P probably damaging Het
Homez T C 14: 54,857,807 E148G possibly damaging Het
Kcnab3 G A 11: 69,326,746 C22Y possibly damaging Het
Kcnh8 C A 17: 52,877,981 S430R probably damaging Het
Kcnn2 T C 18: 45,559,731 C125R probably benign Het
Klhl7 G A 5: 24,141,187 R277Q possibly damaging Het
Krt78 A G 15: 101,946,899 S826P probably benign Het
Krtap14 T C 16: 88,826,031 Y20C possibly damaging Het
Lrcol1 A G 5: 110,354,297 probably null Het
Lrrc10b G A 19: 10,456,862 P152S probably damaging Het
Lrrn3 C G 12: 41,453,125 D398H probably damaging Het
Map3k19 T C 1: 127,822,195 I1140V probably benign Het
Mos G A 4: 3,871,093 T241M probably damaging Het
Nol8 A G 13: 49,654,425 E39G possibly damaging Het
Olfm1 T G 2: 28,214,786 S212A probably benign Het
Olfr319 T A 11: 58,701,807 F35L probably damaging Het
Papd7 A T 13: 69,502,900 probably null Het
Plec G T 15: 76,176,962 T2947K probably damaging Het
Rasgrp3 A G 17: 75,516,355 M474V probably benign Het
Ryr1 T C 7: 29,019,983 Y4333C unknown Het
Scrn2 G C 11: 97,033,500 probably null Het
Slc4a11 A G 2: 130,684,946 V754A probably damaging Het
Slco2b1 A G 7: 99,685,988 F195S probably damaging Het
Slfn9 A C 11: 82,981,390 M840R possibly damaging Het
Speer4b T C 5: 27,501,265 N35D probably damaging Het
Taf1d T A 9: 15,309,954 D185E probably damaging Het
Taok2 A G 7: 126,876,041 L245P probably damaging Het
Ticam2 T C 18: 46,560,779 I80M probably damaging Het
Tmem268 G A 4: 63,583,927 V331I probably benign Het
Tmem55a G T 4: 14,912,458 R189L probably damaging Het
Tsga10 T C 1: 37,801,850 E425G probably damaging Het
Ttc7 A G 17: 87,346,705 probably null Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Unc13a T C 8: 71,654,845 H601R probably damaging Het
Vmn2r102 A T 17: 19,660,399 M1L probably benign Het
Vmn2r120 G T 17: 57,509,125 N743K probably damaging Het
Wnt6 C A 1: 74,784,136 probably null Het
Wnt6 A C 1: 74,784,137 probably null Het
Wnt8a T A 18: 34,547,472 C297S probably damaging Het
Zfp786 T C 6: 47,820,153 Q617R probably benign Het
Zfp91 A G 19: 12,776,410 probably null Het
Zw10 T A 9: 49,068,683 F371L probably damaging Het
Other mutations in Slc22a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02033:Slc22a12 APN 19 6537814 missense probably benign 0.19
IGL02586:Slc22a12 APN 19 6540457 missense probably benign 0.03
R1353:Slc22a12 UTSW 19 6537782 missense possibly damaging 0.66
R1757:Slc22a12 UTSW 19 6536731 splice site probably null
R1816:Slc22a12 UTSW 19 6542653 nonsense probably null
R2254:Slc22a12 UTSW 19 6542541 missense possibly damaging 0.86
R4110:Slc22a12 UTSW 19 6540628 missense probably damaging 1.00
R4125:Slc22a12 UTSW 19 6538788 missense probably damaging 0.99
R4342:Slc22a12 UTSW 19 6541099 missense probably benign 0.15
R4762:Slc22a12 UTSW 19 6538444 missense probably benign 0.02
R5690:Slc22a12 UTSW 19 6536848 missense probably benign 0.00
R5772:Slc22a12 UTSW 19 6540449 missense possibly damaging 0.67
R5946:Slc22a12 UTSW 19 6537851 missense probably damaging 1.00
R6137:Slc22a12 UTSW 19 6542724 missense probably benign 0.07
X0062:Slc22a12 UTSW 19 6537127 missense probably damaging 1.00
Z1088:Slc22a12 UTSW 19 6538463 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- CTCAGCTAGCACACCACATTTT -3'
(R):5'- AAATGCCTGGTCTCCCATAGG -3'

Sequencing Primer
(F):5'- AGCACACCACATTTTTGCCTC -3'
(R):5'- TGGTCTCCCATAGGCTGAC -3'
Posted On2016-04-15