Incidental Mutation 'R4928:Zdbf2'
ID 380951
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Name zinc finger, DBF-type containing 2
Synonyms 4930431J08Rik, 9330107J05Rik
MMRRC Submission 042529-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.119) question?
Stock # R4928 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 63312424-63353735 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 63347973 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 2117 (D2117E)
Ref Sequence ENSEMBL: ENSMUSP00000109767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]
AlphaFold Q5SS00
Predicted Effect possibly damaging
Transcript: ENSMUST00000029025
AA Change: D2117E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: D2117E

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114132
AA Change: D2117E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: D2117E

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Meta Mutation Damage Score 0.1636 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 98% (123/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530021J07Rik G T 7: 82,805,086 (GRCm39) noncoding transcript Het
Aasdh T A 5: 77,044,535 (GRCm39) K118N possibly damaging Het
Abca14 A T 7: 119,923,803 (GRCm39) N1620I possibly damaging Het
Acap1 A T 11: 69,776,641 (GRCm39) S149T possibly damaging Het
Adgre1 T A 17: 57,751,064 (GRCm39) Y579* probably null Het
Aifm3 T C 16: 17,318,296 (GRCm39) probably benign Het
Aldh16a1 A G 7: 44,791,385 (GRCm39) W107R probably damaging Het
Amer2 A T 14: 60,616,894 (GRCm39) H363L possibly damaging Het
Arhgap10 A G 8: 78,152,957 (GRCm39) probably null Het
Arhgef6 A T X: 56,280,238 (GRCm39) D742E probably damaging Het
Astn2 A T 4: 65,647,644 (GRCm39) N731K probably damaging Het
Atp1a2 T C 1: 172,105,954 (GRCm39) T904A possibly damaging Het
Atr C T 9: 95,789,352 (GRCm39) R1503W probably damaging Het
Cdh3 G T 8: 107,263,242 (GRCm39) R97L probably benign Het
Chst2 C T 9: 95,288,059 (GRCm39) V96I probably benign Het
Cit T A 5: 116,123,856 (GRCm39) N1464K probably benign Het
Col17a1 A T 19: 47,658,897 (GRCm39) probably null Het
Col4a3 G A 1: 82,688,698 (GRCm39) probably benign Het
Copz1 T A 15: 103,199,757 (GRCm39) S57R probably damaging Het
Cpped1 A T 16: 11,646,143 (GRCm39) F227Y probably damaging Het
Cyp2j12 A T 4: 95,990,388 (GRCm39) probably null Het
Dctn1 T A 6: 83,166,189 (GRCm39) I195N possibly damaging Het
Dhrs7b A G 11: 60,742,751 (GRCm39) I148V probably benign Het
Dnah17 T C 11: 117,918,259 (GRCm39) D4096G probably damaging Het
Dnajc13 T C 9: 104,110,837 (GRCm39) N145D possibly damaging Het
Ecpas A G 4: 58,827,073 (GRCm39) V1020A probably damaging Het
Entrep2 G T 7: 64,409,116 (GRCm39) S426* probably null Het
Ercc6l2 T C 13: 64,042,627 (GRCm39) probably benign Het
Fads6 T G 11: 115,187,387 (GRCm39) I103L probably benign Het
Fat4 T G 3: 39,064,614 (GRCm39) Y4857D probably damaging Het
Fbxl14 T A 6: 119,457,671 (GRCm39) L284Q probably damaging Het
Fkbp9 T C 6: 56,826,655 (GRCm39) V85A possibly damaging Het
Galnt13 T A 2: 54,406,577 (GRCm39) V9E probably damaging Het
Gm14412 A T 2: 177,006,373 (GRCm39) S507R probably benign Het
Gm15142 T A X: 153,421,415 (GRCm39) noncoding transcript Het
Gm4787 T C 12: 81,425,612 (GRCm39) E182G probably benign Het
Gm6811 C A 17: 21,314,893 (GRCm39) noncoding transcript Het
Gm9791 A T 3: 34,059,218 (GRCm39) noncoding transcript Het
Hoxb7 A T 11: 96,180,336 (GRCm39) probably null Het
Ift122 T A 6: 115,892,819 (GRCm39) probably benign Het
Krt28 C T 11: 99,265,458 (GRCm39) V70I probably benign Het
Lig1 T C 7: 13,032,664 (GRCm39) S459P probably damaging Het
Lrfn3 C T 7: 30,060,048 (GRCm39) R59H possibly damaging Het
Mavs T C 2: 131,088,663 (GRCm39) V489A probably benign Het
Mcm8 C T 2: 132,681,399 (GRCm39) P625L probably benign Het
Megf10 G T 18: 57,373,745 (GRCm39) R181L probably benign Het
Mgrn1 G A 16: 4,745,726 (GRCm39) G440D probably benign Het
Mllt3 T C 4: 87,700,642 (GRCm39) probably null Het
Muc5ac T A 7: 141,371,639 (GRCm39) Y2613* probably null Het
Myh14 C T 7: 44,284,926 (GRCm39) G662S probably benign Het
Myod1 T A 7: 46,026,474 (GRCm39) N126K probably damaging Het
Nae1 A T 8: 105,242,774 (GRCm39) H439Q possibly damaging Het
Narf T A 11: 121,135,765 (GRCm39) V136E possibly damaging Het
Ncapd3 T A 9: 26,983,031 (GRCm39) C926* probably null Het
Ndufv2 C A 17: 66,399,653 (GRCm39) probably null Het
Neb T C 2: 52,102,987 (GRCm39) S449G possibly damaging Het
Nek10 C T 14: 14,930,577 (GRCm38) P698L probably damaging Het
Nox3 T A 17: 3,685,550 (GRCm39) E566V probably null Het
Oas1a C T 5: 121,043,787 (GRCm39) R115H probably benign Het
Or10ag60 C A 2: 87,438,487 (GRCm39) L252I probably benign Het
Or51b6 A G 7: 103,555,879 (GRCm39) T78A probably damaging Het
Or5w19 A G 2: 87,698,574 (GRCm39) M80V probably benign Het
Or8k30 T A 2: 86,339,469 (GRCm39) L222H probably damaging Het
Pbld2 A G 10: 62,883,778 (GRCm39) H142R probably damaging Het
Pcdha4 C T 18: 37,087,869 (GRCm39) T684M probably benign Het
Phc3 G T 3: 31,005,068 (GRCm39) T175N probably damaging Het
Pigs G T 11: 78,219,828 (GRCm39) V68L probably damaging Het
Pik3c2g T A 6: 139,913,528 (GRCm39) D857E possibly damaging Het
Pitpnm3 G A 11: 71,953,998 (GRCm39) P550S probably damaging Het
Pla2g15 G A 8: 106,889,850 (GRCm39) W374* probably null Het
Ptpn14 G A 1: 189,554,839 (GRCm39) C133Y probably damaging Het
Ptpn20 A G 14: 33,336,446 (GRCm39) N95S probably benign Het
Ptrh2 G T 11: 86,580,862 (GRCm39) V160F probably damaging Het
Rapgef3 T C 15: 97,655,256 (GRCm39) D486G probably damaging Het
Rev3l T G 10: 39,699,981 (GRCm39) S1493A probably benign Het
Rgs9 T A 11: 109,116,570 (GRCm39) D411V probably benign Het
Rgsl1 A T 1: 153,669,514 (GRCm39) Y291N probably damaging Het
Rprd2 A G 3: 95,671,849 (GRCm39) Y1185H probably damaging Het
Rpusd3 A G 6: 113,393,167 (GRCm39) probably benign Het
Scnn1a T C 6: 125,299,136 (GRCm39) I72T probably damaging Het
Sdk1 A T 5: 141,842,758 (GRCm39) probably benign Het
Sfmbt2 T C 2: 10,450,556 (GRCm39) L277P probably benign Het
Sgf29 A G 7: 126,264,154 (GRCm39) E73G probably damaging Het
Slc12a6 T A 2: 112,183,306 (GRCm39) F764L probably damaging Het
Slc4a2 T C 5: 24,640,340 (GRCm39) probably null Het
Slc9a3 T G 13: 74,305,838 (GRCm39) V285G probably damaging Het
Slc9c1 A G 16: 45,395,772 (GRCm39) T608A probably benign Het
Slfnl1 C T 4: 120,392,882 (GRCm39) R325C probably damaging Het
Smarcad1 T A 6: 65,051,898 (GRCm39) F344I probably benign Het
Snrnp70 A T 7: 45,026,705 (GRCm39) probably null Het
Sod2 C T 17: 13,227,073 (GRCm39) T9M probably benign Het
Spag5 T A 11: 78,205,199 (GRCm39) S633T probably damaging Het
Spta1 A T 1: 174,018,622 (GRCm39) I531L probably benign Het
Stra8 A G 6: 34,910,091 (GRCm39) E60G probably benign Het
Sult2a3 T A 7: 13,845,482 (GRCm39) I126F probably benign Het
Syt1 T C 10: 108,340,373 (GRCm39) H315R possibly damaging Het
Tanc2 T C 11: 105,758,588 (GRCm39) L783P probably damaging Het
Thbs2 C T 17: 14,899,162 (GRCm39) C646Y probably damaging Het
Ticam2 T A 18: 46,693,989 (GRCm39) K33* probably null Het
Trim17 T C 11: 58,845,127 (GRCm39) probably benign Het
Tsr1 G A 11: 74,798,705 (GRCm39) M691I probably benign Het
Ttn T A 2: 76,592,763 (GRCm39) I20790F probably damaging Het
Tubb2b A T 13: 34,312,168 (GRCm39) Y208* probably null Het
Ubr1 T A 2: 120,745,419 (GRCm39) I890F probably damaging Het
Usp54 T C 14: 20,612,260 (GRCm39) E852G probably damaging Het
Vmn2r78 T C 7: 86,603,835 (GRCm39) V671A probably damaging Het
Wipi1 T C 11: 109,470,475 (GRCm39) K315E probably benign Het
Xrn2 T C 2: 146,893,638 (GRCm39) V735A possibly damaging Het
Zfp287 A T 11: 62,604,962 (GRCm39) C648* probably null Het
Zfp369 A G 13: 65,444,614 (GRCm39) T586A possibly damaging Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63,345,673 (GRCm39) missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63,346,364 (GRCm39) missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63,342,197 (GRCm39) missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63,342,236 (GRCm39) missense possibly damaging 0.46
R0143:Zdbf2 UTSW 1 63,347,233 (GRCm39) missense probably benign 0.01
R0147:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0148:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0433:Zdbf2 UTSW 1 63,345,302 (GRCm39) missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63,344,449 (GRCm39) missense possibly damaging 0.66
R0645:Zdbf2 UTSW 1 63,344,109 (GRCm39) missense possibly damaging 0.81
R0765:Zdbf2 UTSW 1 63,344,882 (GRCm39) missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63,342,589 (GRCm39) missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63,342,161 (GRCm39) missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63,342,212 (GRCm39) missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63,342,199 (GRCm39) missense possibly damaging 0.66
R1562:Zdbf2 UTSW 1 63,342,747 (GRCm39) missense possibly damaging 0.83
R1624:Zdbf2 UTSW 1 63,343,018 (GRCm39) missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63,343,493 (GRCm39) missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63,348,131 (GRCm39) missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63,343,408 (GRCm39) nonsense probably null
R1700:Zdbf2 UTSW 1 63,341,900 (GRCm39) missense unknown
R1720:Zdbf2 UTSW 1 63,342,436 (GRCm39) missense possibly damaging 0.46
R1853:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1854:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1973:Zdbf2 UTSW 1 63,348,860 (GRCm39) missense unknown
R2336:Zdbf2 UTSW 1 63,342,623 (GRCm39) missense probably benign 0.00
R2428:Zdbf2 UTSW 1 63,344,774 (GRCm39) missense probably benign 0.04
R3010:Zdbf2 UTSW 1 63,342,224 (GRCm39) missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63,343,364 (GRCm39) missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63,346,636 (GRCm39) missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63,347,579 (GRCm39) missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63,347,830 (GRCm39) missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63,347,483 (GRCm39) missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63,348,940 (GRCm39) missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63,342,020 (GRCm39) missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63,347,951 (GRCm39) missense possibly damaging 0.46
R4779:Zdbf2 UTSW 1 63,342,397 (GRCm39) missense possibly damaging 0.66
R4943:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63,342,809 (GRCm39) missense possibly damaging 0.82
R5095:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R5149:Zdbf2 UTSW 1 63,344,062 (GRCm39) missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63,343,570 (GRCm39) missense possibly damaging 0.66
R5341:Zdbf2 UTSW 1 63,347,092 (GRCm39) missense probably benign 0.27
R5511:Zdbf2 UTSW 1 63,344,836 (GRCm39) missense probably benign 0.03
R5809:Zdbf2 UTSW 1 63,345,035 (GRCm39) missense possibly damaging 0.90
R5902:Zdbf2 UTSW 1 63,345,685 (GRCm39) missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63,319,977 (GRCm39) start gained probably benign
R6245:Zdbf2 UTSW 1 63,343,592 (GRCm39) missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63,346,981 (GRCm39) missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63,342,480 (GRCm39) missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63,346,637 (GRCm39) missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63,344,679 (GRCm39) missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63,343,073 (GRCm39) missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63,343,667 (GRCm39) missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63,343,679 (GRCm39) missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63,347,687 (GRCm39) missense possibly damaging 0.66
R6896:Zdbf2 UTSW 1 63,348,031 (GRCm39) missense probably damaging 0.98
R6997:Zdbf2 UTSW 1 63,329,925 (GRCm39) missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63,345,925 (GRCm39) missense possibly damaging 0.66
R7058:Zdbf2 UTSW 1 63,346,563 (GRCm39) missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63,346,718 (GRCm39) missense probably benign
R7177:Zdbf2 UTSW 1 63,334,120 (GRCm39) missense possibly damaging 0.94
R7184:Zdbf2 UTSW 1 63,345,664 (GRCm39) missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63,342,563 (GRCm39) missense possibly damaging 0.90
R7387:Zdbf2 UTSW 1 63,343,198 (GRCm39) missense possibly damaging 0.46
R7468:Zdbf2 UTSW 1 63,346,669 (GRCm39) missense probably benign
R7695:Zdbf2 UTSW 1 63,346,529 (GRCm39) missense possibly damaging 0.83
R7712:Zdbf2 UTSW 1 63,344,530 (GRCm39) missense possibly damaging 0.83
R7735:Zdbf2 UTSW 1 63,343,264 (GRCm39) missense possibly damaging 0.66
R7736:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
R7759:Zdbf2 UTSW 1 63,347,535 (GRCm39) missense possibly damaging 0.46
R7796:Zdbf2 UTSW 1 63,342,583 (GRCm39) missense possibly damaging 0.90
R7908:Zdbf2 UTSW 1 63,345,986 (GRCm39) missense possibly damaging 0.46
R7970:Zdbf2 UTSW 1 63,343,330 (GRCm39) missense possibly damaging 0.92
R8076:Zdbf2 UTSW 1 63,345,260 (GRCm39) missense possibly damaging 0.92
R8152:Zdbf2 UTSW 1 63,345,572 (GRCm39) missense possibly damaging 0.92
R8195:Zdbf2 UTSW 1 63,343,225 (GRCm39) missense possibly damaging 0.83
R8272:Zdbf2 UTSW 1 63,345,142 (GRCm39) missense probably benign
R8306:Zdbf2 UTSW 1 63,343,234 (GRCm39) missense possibly damaging 0.66
R8309:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R8323:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.46
R8400:Zdbf2 UTSW 1 63,344,135 (GRCm39) missense possibly damaging 0.92
R8443:Zdbf2 UTSW 1 63,345,166 (GRCm39) missense possibly damaging 0.83
R8460:Zdbf2 UTSW 1 63,348,729 (GRCm39) small deletion probably benign
R8528:Zdbf2 UTSW 1 63,342,545 (GRCm39) missense possibly damaging 0.82
R8812:Zdbf2 UTSW 1 63,347,272 (GRCm39) missense probably benign 0.00
R8962:Zdbf2 UTSW 1 63,347,162 (GRCm39) missense probably benign 0.00
R9061:Zdbf2 UTSW 1 63,346,296 (GRCm39) missense
R9072:Zdbf2 UTSW 1 63,344,923 (GRCm39) missense possibly damaging 0.83
R9232:Zdbf2 UTSW 1 63,347,168 (GRCm39) missense possibly damaging 0.66
R9257:Zdbf2 UTSW 1 63,345,400 (GRCm39) missense probably damaging 1.00
R9411:Zdbf2 UTSW 1 63,343,288 (GRCm39) missense probably damaging 0.97
R9470:Zdbf2 UTSW 1 63,344,784 (GRCm39) missense possibly damaging 0.82
R9606:Zdbf2 UTSW 1 63,342,536 (GRCm39) missense possibly damaging 0.92
R9621:Zdbf2 UTSW 1 63,342,635 (GRCm39) missense possibly damaging 0.66
RF021:Zdbf2 UTSW 1 63,341,811 (GRCm39) missense possibly damaging 0.82
X0018:Zdbf2 UTSW 1 63,344,510 (GRCm39) missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
X0057:Zdbf2 UTSW 1 63,344,549 (GRCm39) missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63,344,696 (GRCm39) missense probably benign 0.04
Z1176:Zdbf2 UTSW 1 63,343,404 (GRCm39) missense possibly damaging 0.83
Z1177:Zdbf2 UTSW 1 63,348,362 (GRCm39) missense unknown
Z1177:Zdbf2 UTSW 1 63,343,245 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTAATAGGCATGACCCAAAGCC -3'
(R):5'- TCGGTCGCTTTCAGCTGAATC -3'

Sequencing Primer
(F):5'- GCCCAATGCAGGAGACG -3'
(R):5'- GGTCGCTTTCAGCTGAATCCAAATAG -3'
Posted On 2016-04-15