Mutagenetix > Incidental Mutation

Incidental Mutation 'R4928:Zdbf2'

380951

Institutional Source

Beutler Lab

Gene Symbol

Zdbf2

Ensembl Gene

ENSMUSG00000027520

Gene Name

zinc finger, DBF-type containing 2

Synonyms

4930431J08Rik, 9330107J05Rik

MMRRC Submission

042529-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R4928 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63273265-63314576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 63308814 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 2117 (D2117E)

Ref Sequence

ENSEMBL: ENSMUSP00000109767 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]

AlphaFold

Q5SS00

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029025
AA Change: D2117E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: D2117E

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114132
AA Change: D2117E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: D2117E

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Meta Mutation Damage Score

0.1636

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

98% (123/126)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 110 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530021J07Rik	G	T	7: 83,155,878		noncoding transcript	Het
Aasdh	T	A	5: 76,896,688	K118N	possibly damaging	Het
Abca14	A	T	7: 120,324,580	N1620I	possibly damaging	Het
Acap1	A	T	11: 69,885,815	S149T	possibly damaging	Het
Adgre1	T	A	17: 57,444,064	Y579*	probably null	Het
AI314180	A	G	4: 58,827,073	V1020A	probably damaging	Het
Aifm3	T	C	16: 17,500,432		probably benign	Het
Aldh16a1	A	G	7: 45,141,961	W107R	probably damaging	Het
Amer2	A	T	14: 60,379,445	H363L	possibly damaging	Het
Arhgap10	A	G	8: 77,426,328		probably null	Het
Arhgef6	A	T	X: 57,234,878	D742E	probably damaging	Het
Astn2	A	T	4: 65,729,407	N731K	probably damaging	Het
Atp1a2	T	C	1: 172,278,387	T904A	possibly damaging	Het
Atr	C	T	9: 95,907,299	R1503W	probably damaging	Het
Cdh3	G	T	8: 106,536,610	R97L	probably benign	Het
Chst2	C	T	9: 95,406,006	V96I	probably benign	Het
Cit	T	A	5: 115,985,797	N1464K	probably benign	Het
Col17a1	A	T	19: 47,670,458		probably null	Het
Col4a3	G	A	1: 82,710,977		probably benign	Het
Copz1	T	A	15: 103,291,330	S57R	probably damaging	Het
Cpped1	A	T	16: 11,828,279	F227Y	probably damaging	Het
Cyp2j12	A	T	4: 96,102,151		probably null	Het
Dctn1	T	A	6: 83,189,207	I195N	possibly damaging	Het
Dhrs7b	A	G	11: 60,851,925	I148V	probably benign	Het
Dnah17	T	C	11: 118,027,433	D4096G	probably damaging	Het
Dnajc13	T	C	9: 104,233,638	N145D	possibly damaging	Het
Ercc6l2	T	C	13: 63,894,813		probably benign	Het
Fads6	T	G	11: 115,296,561	I103L	probably benign	Het
Fam189a1	G	T	7: 64,759,368	S426*	probably null	Het
Fat4	T	G	3: 39,010,465	Y4857D	probably damaging	Het
Fbxl14	T	A	6: 119,480,710	L284Q	probably damaging	Het
Fkbp9	T	C	6: 56,849,670	V85A	possibly damaging	Het
Galnt13	T	A	2: 54,516,565	V9E	probably damaging	Het
Gm14412	A	T	2: 177,314,580	S507R	probably benign	Het
Gm15142	T	A	X: 154,638,419		noncoding transcript	Het
Gm4787	T	C	12: 81,378,838	E182G	probably benign	Het
Gm6811	C	A	17: 21,094,631		noncoding transcript	Het
Gm9791	A	T	3: 34,005,069		noncoding transcript	Het
Hoxb7	A	T	11: 96,289,510		probably null	Het
Ift122	T	A	6: 115,915,858		probably benign	Het
Krt28	C	T	11: 99,374,632	V70I	probably benign	Het
Lig1	T	C	7: 13,298,738	S459P	probably damaging	Het
Lrfn3	C	T	7: 30,360,623	R59H	possibly damaging	Het
Mavs	T	C	2: 131,246,743	V489A	probably benign	Het
Mcm8	C	T	2: 132,839,479	P625L	probably benign	Het
Megf10	G	T	18: 57,240,673	R181L	probably benign	Het
Mgrn1	G	A	16: 4,927,862	G440D	probably benign	Het
Mllt3	T	C	4: 87,782,405		probably null	Het
Muc5ac	T	A	7: 141,817,902	Y2613*	probably null	Het
Myh14	C	T	7: 44,635,502	G662S	probably benign	Het
Myod1	T	A	7: 46,377,050	N126K	probably damaging	Het
Nae1	A	T	8: 104,516,142	H439Q	possibly damaging	Het
Narf	T	A	11: 121,244,939	V136E	possibly damaging	Het
Ncapd3	T	A	9: 27,071,735	C926*	probably null	Het
Ndufv2	C	A	17: 66,092,658		probably null	Het
Neb	T	C	2: 52,212,975	S449G	possibly damaging	Het
Nek10	C	T	14: 14,930,577	P698L	probably damaging	Het
Nox3	T	A	17: 3,635,275	E566V	probably null	Het
Oas1a	C	T	5: 120,905,724	R115H	probably benign	Het
Olfr1076	T	A	2: 86,509,125	L222H	probably damaging	Het
Olfr1130	C	A	2: 87,608,143	L252I	probably benign	Het
Olfr1152	A	G	2: 87,868,230	M80V	probably benign	Het
Olfr65	A	G	7: 103,906,672	T78A	probably damaging	Het
Pbld2	A	G	10: 63,047,999	H142R	probably damaging	Het
Pcdha4	C	T	18: 36,954,816	T684M	probably benign	Het
Phc3	G	T	3: 30,950,919	T175N	probably damaging	Het
Pigs	G	T	11: 78,329,002	V68L	probably damaging	Het
Pik3c2g	T	A	6: 139,967,802	D857E	possibly damaging	Het
Pitpnm3	G	A	11: 72,063,172	P550S	probably damaging	Het
Pla2g15	G	A	8: 106,163,218	W374*	probably null	Het
Ptpn14	G	A	1: 189,822,642	C133Y	probably damaging	Het
Ptpn20	A	G	14: 33,614,489	N95S	probably benign	Het
Ptrh2	G	T	11: 86,690,036	V160F	probably damaging	Het
Rapgef3	T	C	15: 97,757,375	D486G	probably damaging	Het
Rev3l	T	G	10: 39,823,985	S1493A	probably benign	Het
Rgs9	T	A	11: 109,225,744	D411V	probably benign	Het
Rgsl1	A	T	1: 153,793,768	Y291N	probably damaging	Het
Rprd2	A	G	3: 95,764,537	Y1185H	probably damaging	Het
Rpusd3	A	G	6: 113,416,206		probably benign	Het
Scnn1a	T	C	6: 125,322,173	I72T	probably damaging	Het
Sdk1	A	T	5: 141,857,003		probably benign	Het
Sfmbt2	T	C	2: 10,445,745	L277P	probably benign	Het
Sgf29	A	G	7: 126,664,982	E73G	probably damaging	Het
Slc12a6	T	A	2: 112,352,961	F764L	probably damaging	Het
Slc4a2	T	C	5: 24,435,342		probably null	Het
Slc9a3	T	G	13: 74,157,719	V285G	probably damaging	Het
Slc9c1	A	G	16: 45,575,409	T608A	probably benign	Het
Slfnl1	C	T	4: 120,535,685	R325C	probably damaging	Het
Smarcad1	T	A	6: 65,074,914	F344I	probably benign	Het
Snrnp70	A	T	7: 45,377,281		probably null	Het
Sod2	C	T	17: 13,008,186	T9M	probably benign	Het
Spag5	T	A	11: 78,314,373	S633T	probably damaging	Het
Spta1	A	T	1: 174,191,056	I531L	probably benign	Het
Stra8	A	G	6: 34,933,156	E60G	probably benign	Het
Sult2a3	T	A	7: 14,111,557	I126F	probably benign	Het
Syt1	T	C	10: 108,504,512	H315R	possibly damaging	Het
Tanc2	T	C	11: 105,867,762	L783P	probably damaging	Het
Thbs2	C	T	17: 14,678,900	C646Y	probably damaging	Het
Ticam2	T	A	18: 46,560,922	K33*	probably null	Het
Trim17	T	C	11: 58,954,301		probably benign	Het
Tsr1	G	A	11: 74,907,879	M691I	probably benign	Het
Ttn	T	A	2: 76,762,419	I20790F	probably damaging	Het
Tubb2b	A	T	13: 34,128,185	Y208*	probably null	Het
Ubr1	T	A	2: 120,914,938	I890F	probably damaging	Het
Usp54	T	C	14: 20,562,192	E852G	probably damaging	Het
Vmn2r78	T	C	7: 86,954,627	V671A	probably damaging	Het
Wipi1	T	C	11: 109,579,649	K315E	probably benign	Het
Xrn2	T	C	2: 147,051,718	V735A	possibly damaging	Het
Zfp287	A	T	11: 62,714,136	C648*	probably null	Het
Zfp369	A	G	13: 65,296,800	T586A	possibly damaging	Het

Other mutations in Zdbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Zdbf2	APN	1	63306514	missense	possibly damaging	0.92
IGL00796:Zdbf2	APN	1	63307205	missense	probably benign	0.04
IGL00801:Zdbf2	APN	1	63303038	missense	possibly damaging	0.66
IGL02803:Zdbf2	APN	1	63303077	missense	possibly damaging	0.46
R0143:Zdbf2	UTSW	1	63308074	missense	probably benign	0.01
R0147:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0148:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0433:Zdbf2	UTSW	1	63306143	missense	possibly damaging	0.46
R0502:Zdbf2	UTSW	1	63305290	missense	possibly damaging	0.66
R0645:Zdbf2	UTSW	1	63304950	missense	possibly damaging	0.81
R0765:Zdbf2	UTSW	1	63305723	missense	possibly damaging	0.46
R1068:Zdbf2	UTSW	1	63303430	missense	possibly damaging	0.94
R1216:Zdbf2	UTSW	1	63303002	missense	possibly damaging	0.83
R1235:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R1352:Zdbf2	UTSW	1	63303053	missense	probably damaging	0.96
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1435:Zdbf2	UTSW	1	63303040	missense	possibly damaging	0.66
R1562:Zdbf2	UTSW	1	63303588	missense	possibly damaging	0.83
R1624:Zdbf2	UTSW	1	63303859	missense	possibly damaging	0.66
R1635:Zdbf2	UTSW	1	63304334	missense	possibly damaging	0.92
R1644:Zdbf2	UTSW	1	63308972	missense	possibly damaging	0.66
R1662:Zdbf2	UTSW	1	63304249	nonsense	probably null
R1700:Zdbf2	UTSW	1	63302741	missense	unknown
R1720:Zdbf2	UTSW	1	63303277	missense	possibly damaging	0.46
R1853:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1854:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1973:Zdbf2	UTSW	1	63309701	missense	unknown
R2336:Zdbf2	UTSW	1	63303464	missense	probably benign	0.00
R2428:Zdbf2	UTSW	1	63305615	missense	probably benign	0.04
R3010:Zdbf2	UTSW	1	63303065	missense	possibly damaging	0.92
R3034:Zdbf2	UTSW	1	63304205	missense	probably damaging	0.96
R3079:Zdbf2	UTSW	1	63307477	missense	probably benign	0.05
R3196:Zdbf2	UTSW	1	63308420	missense	possibly damaging	0.46
R3711:Zdbf2	UTSW	1	63308671	missense	possibly damaging	0.83
R3845:Zdbf2	UTSW	1	63308324	missense	possibly damaging	0.66
R4093:Zdbf2	UTSW	1	63309781	missense	possibly damaging	0.83
R4250:Zdbf2	UTSW	1	63302861	missense	possibly damaging	0.46
R4592:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R4721:Zdbf2	UTSW	1	63308792	missense	possibly damaging	0.46
R4779:Zdbf2	UTSW	1	63303238	missense	possibly damaging	0.66
R4943:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.92
R5025:Zdbf2	UTSW	1	63303650	missense	possibly damaging	0.82
R5095:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R5149:Zdbf2	UTSW	1	63304903	missense	possibly damaging	0.83
R5326:Zdbf2	UTSW	1	63304411	missense	possibly damaging	0.66
R5341:Zdbf2	UTSW	1	63307933	missense	probably benign	0.27
R5511:Zdbf2	UTSW	1	63305677	missense	probably benign	0.03
R5809:Zdbf2	UTSW	1	63305876	missense	possibly damaging	0.90
R5902:Zdbf2	UTSW	1	63306526	missense	possibly damaging	0.83
R6162:Zdbf2	UTSW	1	63280818	start gained	probably benign
R6245:Zdbf2	UTSW	1	63304433	missense	possibly damaging	0.46
R6332:Zdbf2	UTSW	1	63307822	missense	possibly damaging	0.66
R6361:Zdbf2	UTSW	1	63303321	missense	possibly damaging	0.66
R6489:Zdbf2	UTSW	1	63307478	missense	possibly damaging	0.46
R6517:Zdbf2	UTSW	1	63305520	missense	possibly damaging	0.81
R6624:Zdbf2	UTSW	1	63303914	missense	possibly damaging	0.46
R6643:Zdbf2	UTSW	1	63304508	missense	possibly damaging	0.82
R6786:Zdbf2	UTSW	1	63304520	missense	possibly damaging	0.46
R6808:Zdbf2	UTSW	1	63308528	missense	possibly damaging	0.66
R6896:Zdbf2	UTSW	1	63308872	missense	probably damaging	0.98
R6997:Zdbf2	UTSW	1	63290766	missense	probably benign	0.09
R7011:Zdbf2	UTSW	1	63306766	missense	possibly damaging	0.66
R7058:Zdbf2	UTSW	1	63307404	missense	possibly damaging	0.66
R7066:Zdbf2	UTSW	1	63307559	missense	probably benign
R7177:Zdbf2	UTSW	1	63294961	missense	possibly damaging	0.94
R7184:Zdbf2	UTSW	1	63306505	missense	possibly damaging	0.92
R7273:Zdbf2	UTSW	1	63303404	missense	possibly damaging	0.90
R7387:Zdbf2	UTSW	1	63304039	missense	possibly damaging	0.46
R7468:Zdbf2	UTSW	1	63307510	missense	probably benign
R7695:Zdbf2	UTSW	1	63307370	missense	possibly damaging	0.83
R7712:Zdbf2	UTSW	1	63305371	missense	possibly damaging	0.83
R7735:Zdbf2	UTSW	1	63304105	missense	possibly damaging	0.66
R7736:Zdbf2	UTSW	1	63308007	nonsense	probably null
R7759:Zdbf2	UTSW	1	63308376	missense	possibly damaging	0.46
R7796:Zdbf2	UTSW	1	63303424	missense	possibly damaging	0.90
R7908:Zdbf2	UTSW	1	63306827	missense	possibly damaging	0.46
R7970:Zdbf2	UTSW	1	63304171	missense	possibly damaging	0.92
R8076:Zdbf2	UTSW	1	63306101	missense	possibly damaging	0.92
R8152:Zdbf2	UTSW	1	63306413	missense	possibly damaging	0.92
R8195:Zdbf2	UTSW	1	63304066	missense	possibly damaging	0.83
R8272:Zdbf2	UTSW	1	63305983	missense	probably benign
R8306:Zdbf2	UTSW	1	63304075	missense	possibly damaging	0.66
R8309:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R8323:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.46
R8400:Zdbf2	UTSW	1	63304976	missense	possibly damaging	0.92
R8443:Zdbf2	UTSW	1	63306007	missense	possibly damaging	0.83
R8460:Zdbf2	UTSW	1	63309570	small deletion	probably benign
R8528:Zdbf2	UTSW	1	63303386	missense	possibly damaging	0.82
R8812:Zdbf2	UTSW	1	63308113	missense	probably benign	0.00
R8962:Zdbf2	UTSW	1	63308003	missense	probably benign	0.00
R9061:Zdbf2	UTSW	1	63307137	missense
R9072:Zdbf2	UTSW	1	63305764	missense	possibly damaging	0.83
R9232:Zdbf2	UTSW	1	63308009	missense	possibly damaging	0.66
R9257:Zdbf2	UTSW	1	63306241	missense	probably damaging	1.00
R9411:Zdbf2	UTSW	1	63304129	missense	probably damaging	0.97
R9470:Zdbf2	UTSW	1	63305625	missense	possibly damaging	0.82
R9606:Zdbf2	UTSW	1	63303377	missense	possibly damaging	0.92
R9621:Zdbf2	UTSW	1	63303476	missense	possibly damaging	0.66
RF021:Zdbf2	UTSW	1	63302652	missense	possibly damaging	0.82
X0018:Zdbf2	UTSW	1	63305351	missense	possibly damaging	0.92
X0027:Zdbf2	UTSW	1	63308007	nonsense	probably null
X0057:Zdbf2	UTSW	1	63305390	missense	possibly damaging	0.66
X0063:Zdbf2	UTSW	1	63305537	missense	probably benign	0.04
Z1176:Zdbf2	UTSW	1	63304245	missense	possibly damaging	0.83
Z1177:Zdbf2	UTSW	1	63304086	frame shift	probably null
Z1177:Zdbf2	UTSW	1	63309203	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TTAATAGGCATGACCCAAAGCC -3'
(R):5'- TCGGTCGCTTTCAGCTGAATC -3'

Sequencing Primer
(F):5'- GCCCAATGCAGGAGACG -3'
(R):5'- GGTCGCTTTCAGCTGAATCCAAATAG -3'

Posted On

2016-04-15