Incidental Mutation 'R4928:Ubr1'
ID 380965
Institutional Source Beutler Lab
Gene Symbol Ubr1
Ensembl Gene ENSMUSG00000027272
Gene Name ubiquitin protein ligase E3 component n-recognin 1
Synonyms E3 alpha
MMRRC Submission 042529-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.826) question?
Stock # R4928 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 120690750-120801196 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 120745419 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 890 (I890F)
Ref Sequence ENSEMBL: ENSMUSP00000028728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028728]
AlphaFold O70481
Predicted Effect probably damaging
Transcript: ENSMUST00000028728
AA Change: I890F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: I890F

DomainStartEndE-ValueType
ZnF_UBR1 97 167 1.24e-35 SMART
Pfam:ClpS 221 301 8e-24 PFAM
low complexity region 918 936 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1070 1081 N/A INTRINSIC
Blast:RING 1101 1203 4e-34 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129790
Meta Mutation Damage Score 0.4906 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 98% (123/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530021J07Rik G T 7: 82,805,086 (GRCm39) noncoding transcript Het
Aasdh T A 5: 77,044,535 (GRCm39) K118N possibly damaging Het
Abca14 A T 7: 119,923,803 (GRCm39) N1620I possibly damaging Het
Acap1 A T 11: 69,776,641 (GRCm39) S149T possibly damaging Het
Adgre1 T A 17: 57,751,064 (GRCm39) Y579* probably null Het
Aifm3 T C 16: 17,318,296 (GRCm39) probably benign Het
Aldh16a1 A G 7: 44,791,385 (GRCm39) W107R probably damaging Het
Amer2 A T 14: 60,616,894 (GRCm39) H363L possibly damaging Het
Arhgap10 A G 8: 78,152,957 (GRCm39) probably null Het
Arhgef6 A T X: 56,280,238 (GRCm39) D742E probably damaging Het
Astn2 A T 4: 65,647,644 (GRCm39) N731K probably damaging Het
Atp1a2 T C 1: 172,105,954 (GRCm39) T904A possibly damaging Het
Atr C T 9: 95,789,352 (GRCm39) R1503W probably damaging Het
Cdh3 G T 8: 107,263,242 (GRCm39) R97L probably benign Het
Chst2 C T 9: 95,288,059 (GRCm39) V96I probably benign Het
Cit T A 5: 116,123,856 (GRCm39) N1464K probably benign Het
Col17a1 A T 19: 47,658,897 (GRCm39) probably null Het
Col4a3 G A 1: 82,688,698 (GRCm39) probably benign Het
Copz1 T A 15: 103,199,757 (GRCm39) S57R probably damaging Het
Cpped1 A T 16: 11,646,143 (GRCm39) F227Y probably damaging Het
Cyp2j12 A T 4: 95,990,388 (GRCm39) probably null Het
Dctn1 T A 6: 83,166,189 (GRCm39) I195N possibly damaging Het
Dhrs7b A G 11: 60,742,751 (GRCm39) I148V probably benign Het
Dnah17 T C 11: 117,918,259 (GRCm39) D4096G probably damaging Het
Dnajc13 T C 9: 104,110,837 (GRCm39) N145D possibly damaging Het
Ecpas A G 4: 58,827,073 (GRCm39) V1020A probably damaging Het
Entrep2 G T 7: 64,409,116 (GRCm39) S426* probably null Het
Ercc6l2 T C 13: 64,042,627 (GRCm39) probably benign Het
Fads6 T G 11: 115,187,387 (GRCm39) I103L probably benign Het
Fat4 T G 3: 39,064,614 (GRCm39) Y4857D probably damaging Het
Fbxl14 T A 6: 119,457,671 (GRCm39) L284Q probably damaging Het
Fkbp9 T C 6: 56,826,655 (GRCm39) V85A possibly damaging Het
Galnt13 T A 2: 54,406,577 (GRCm39) V9E probably damaging Het
Gm14412 A T 2: 177,006,373 (GRCm39) S507R probably benign Het
Gm15142 T A X: 153,421,415 (GRCm39) noncoding transcript Het
Gm4787 T C 12: 81,425,612 (GRCm39) E182G probably benign Het
Gm6811 C A 17: 21,314,893 (GRCm39) noncoding transcript Het
Gm9791 A T 3: 34,059,218 (GRCm39) noncoding transcript Het
Hoxb7 A T 11: 96,180,336 (GRCm39) probably null Het
Ift122 T A 6: 115,892,819 (GRCm39) probably benign Het
Krt28 C T 11: 99,265,458 (GRCm39) V70I probably benign Het
Lig1 T C 7: 13,032,664 (GRCm39) S459P probably damaging Het
Lrfn3 C T 7: 30,060,048 (GRCm39) R59H possibly damaging Het
Mavs T C 2: 131,088,663 (GRCm39) V489A probably benign Het
Mcm8 C T 2: 132,681,399 (GRCm39) P625L probably benign Het
Megf10 G T 18: 57,373,745 (GRCm39) R181L probably benign Het
Mgrn1 G A 16: 4,745,726 (GRCm39) G440D probably benign Het
Mllt3 T C 4: 87,700,642 (GRCm39) probably null Het
Muc5ac T A 7: 141,371,639 (GRCm39) Y2613* probably null Het
Myh14 C T 7: 44,284,926 (GRCm39) G662S probably benign Het
Myod1 T A 7: 46,026,474 (GRCm39) N126K probably damaging Het
Nae1 A T 8: 105,242,774 (GRCm39) H439Q possibly damaging Het
Narf T A 11: 121,135,765 (GRCm39) V136E possibly damaging Het
Ncapd3 T A 9: 26,983,031 (GRCm39) C926* probably null Het
Ndufv2 C A 17: 66,399,653 (GRCm39) probably null Het
Neb T C 2: 52,102,987 (GRCm39) S449G possibly damaging Het
Nek10 C T 14: 14,930,577 (GRCm38) P698L probably damaging Het
Nox3 T A 17: 3,685,550 (GRCm39) E566V probably null Het
Oas1a C T 5: 121,043,787 (GRCm39) R115H probably benign Het
Or10ag60 C A 2: 87,438,487 (GRCm39) L252I probably benign Het
Or51b6 A G 7: 103,555,879 (GRCm39) T78A probably damaging Het
Or5w19 A G 2: 87,698,574 (GRCm39) M80V probably benign Het
Or8k30 T A 2: 86,339,469 (GRCm39) L222H probably damaging Het
Pbld2 A G 10: 62,883,778 (GRCm39) H142R probably damaging Het
Pcdha4 C T 18: 37,087,869 (GRCm39) T684M probably benign Het
Phc3 G T 3: 31,005,068 (GRCm39) T175N probably damaging Het
Pigs G T 11: 78,219,828 (GRCm39) V68L probably damaging Het
Pik3c2g T A 6: 139,913,528 (GRCm39) D857E possibly damaging Het
Pitpnm3 G A 11: 71,953,998 (GRCm39) P550S probably damaging Het
Pla2g15 G A 8: 106,889,850 (GRCm39) W374* probably null Het
Ptpn14 G A 1: 189,554,839 (GRCm39) C133Y probably damaging Het
Ptpn20 A G 14: 33,336,446 (GRCm39) N95S probably benign Het
Ptrh2 G T 11: 86,580,862 (GRCm39) V160F probably damaging Het
Rapgef3 T C 15: 97,655,256 (GRCm39) D486G probably damaging Het
Rev3l T G 10: 39,699,981 (GRCm39) S1493A probably benign Het
Rgs9 T A 11: 109,116,570 (GRCm39) D411V probably benign Het
Rgsl1 A T 1: 153,669,514 (GRCm39) Y291N probably damaging Het
Rprd2 A G 3: 95,671,849 (GRCm39) Y1185H probably damaging Het
Rpusd3 A G 6: 113,393,167 (GRCm39) probably benign Het
Scnn1a T C 6: 125,299,136 (GRCm39) I72T probably damaging Het
Sdk1 A T 5: 141,842,758 (GRCm39) probably benign Het
Sfmbt2 T C 2: 10,450,556 (GRCm39) L277P probably benign Het
Sgf29 A G 7: 126,264,154 (GRCm39) E73G probably damaging Het
Slc12a6 T A 2: 112,183,306 (GRCm39) F764L probably damaging Het
Slc4a2 T C 5: 24,640,340 (GRCm39) probably null Het
Slc9a3 T G 13: 74,305,838 (GRCm39) V285G probably damaging Het
Slc9c1 A G 16: 45,395,772 (GRCm39) T608A probably benign Het
Slfnl1 C T 4: 120,392,882 (GRCm39) R325C probably damaging Het
Smarcad1 T A 6: 65,051,898 (GRCm39) F344I probably benign Het
Snrnp70 A T 7: 45,026,705 (GRCm39) probably null Het
Sod2 C T 17: 13,227,073 (GRCm39) T9M probably benign Het
Spag5 T A 11: 78,205,199 (GRCm39) S633T probably damaging Het
Spta1 A T 1: 174,018,622 (GRCm39) I531L probably benign Het
Stra8 A G 6: 34,910,091 (GRCm39) E60G probably benign Het
Sult2a3 T A 7: 13,845,482 (GRCm39) I126F probably benign Het
Syt1 T C 10: 108,340,373 (GRCm39) H315R possibly damaging Het
Tanc2 T C 11: 105,758,588 (GRCm39) L783P probably damaging Het
Thbs2 C T 17: 14,899,162 (GRCm39) C646Y probably damaging Het
Ticam2 T A 18: 46,693,989 (GRCm39) K33* probably null Het
Trim17 T C 11: 58,845,127 (GRCm39) probably benign Het
Tsr1 G A 11: 74,798,705 (GRCm39) M691I probably benign Het
Ttn T A 2: 76,592,763 (GRCm39) I20790F probably damaging Het
Tubb2b A T 13: 34,312,168 (GRCm39) Y208* probably null Het
Usp54 T C 14: 20,612,260 (GRCm39) E852G probably damaging Het
Vmn2r78 T C 7: 86,603,835 (GRCm39) V671A probably damaging Het
Wipi1 T C 11: 109,470,475 (GRCm39) K315E probably benign Het
Xrn2 T C 2: 146,893,638 (GRCm39) V735A possibly damaging Het
Zdbf2 T A 1: 63,347,973 (GRCm39) D2117E possibly damaging Het
Zfp287 A T 11: 62,604,962 (GRCm39) C648* probably null Het
Zfp369 A G 13: 65,444,614 (GRCm39) T586A possibly damaging Het
Other mutations in Ubr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ubr1 APN 2 120,705,888 (GRCm39) missense possibly damaging 0.65
IGL00570:Ubr1 APN 2 120,771,574 (GRCm39) missense possibly damaging 0.93
IGL00990:Ubr1 APN 2 120,761,353 (GRCm39) missense probably damaging 1.00
IGL01124:Ubr1 APN 2 120,745,386 (GRCm39) missense probably benign
IGL01346:Ubr1 APN 2 120,703,603 (GRCm39) critical splice donor site probably null
IGL01368:Ubr1 APN 2 120,771,612 (GRCm39) splice site probably benign
IGL01539:Ubr1 APN 2 120,756,494 (GRCm39) missense possibly damaging 0.79
IGL01862:Ubr1 APN 2 120,764,823 (GRCm39) missense possibly damaging 0.81
IGL01965:Ubr1 APN 2 120,705,879 (GRCm39) missense probably damaging 0.99
IGL01984:Ubr1 APN 2 120,751,867 (GRCm39) missense probably damaging 0.99
IGL02184:Ubr1 APN 2 120,730,989 (GRCm39) missense probably benign 0.00
IGL02208:Ubr1 APN 2 120,776,830 (GRCm39) missense probably benign 0.00
IGL02415:Ubr1 APN 2 120,801,084 (GRCm39) utr 5 prime probably benign
IGL02517:Ubr1 APN 2 120,694,854 (GRCm39) missense possibly damaging 0.69
IGL02614:Ubr1 APN 2 120,701,460 (GRCm39) splice site probably benign
IGL02627:Ubr1 APN 2 120,771,472 (GRCm39) missense probably damaging 1.00
IGL02718:Ubr1 APN 2 120,745,364 (GRCm39) missense probably damaging 1.00
IGL02741:Ubr1 APN 2 120,771,572 (GRCm39) missense probably benign 0.01
IGL02939:Ubr1 APN 2 120,711,664 (GRCm39) critical splice acceptor site probably null
IGL03081:Ubr1 APN 2 120,791,637 (GRCm39) missense possibly damaging 0.83
IGL03310:Ubr1 APN 2 120,694,898 (GRCm39) missense probably damaging 1.00
IGL03370:Ubr1 APN 2 120,725,641 (GRCm39) missense probably benign
I1329:Ubr1 UTSW 2 120,764,775 (GRCm39) splice site probably benign
R0022:Ubr1 UTSW 2 120,791,654 (GRCm39) splice site probably benign
R0345:Ubr1 UTSW 2 120,734,584 (GRCm39) splice site probably null
R0373:Ubr1 UTSW 2 120,777,138 (GRCm39) missense probably benign 0.01
R0393:Ubr1 UTSW 2 120,737,427 (GRCm39) missense probably damaging 1.00
R0543:Ubr1 UTSW 2 120,711,574 (GRCm39) missense probably damaging 1.00
R0559:Ubr1 UTSW 2 120,778,364 (GRCm39) nonsense probably null
R0723:Ubr1 UTSW 2 120,711,582 (GRCm39) nonsense probably null
R1178:Ubr1 UTSW 2 120,756,510 (GRCm39) nonsense probably null
R1401:Ubr1 UTSW 2 120,786,125 (GRCm39) missense probably benign 0.01
R1485:Ubr1 UTSW 2 120,791,579 (GRCm39) missense probably benign 0.03
R1572:Ubr1 UTSW 2 120,765,800 (GRCm39) splice site probably benign
R1920:Ubr1 UTSW 2 120,761,449 (GRCm39) missense probably benign 0.11
R1921:Ubr1 UTSW 2 120,761,449 (GRCm39) missense probably benign 0.11
R1997:Ubr1 UTSW 2 120,776,754 (GRCm39) critical splice donor site probably null
R2129:Ubr1 UTSW 2 120,773,034 (GRCm39) missense probably benign 0.35
R2147:Ubr1 UTSW 2 120,694,811 (GRCm39) missense probably damaging 1.00
R2191:Ubr1 UTSW 2 120,756,528 (GRCm39) missense probably damaging 0.96
R2288:Ubr1 UTSW 2 120,739,963 (GRCm39) missense probably damaging 1.00
R3409:Ubr1 UTSW 2 120,793,929 (GRCm39) missense probably benign 0.02
R3930:Ubr1 UTSW 2 120,746,951 (GRCm39) missense probably benign 0.20
R3979:Ubr1 UTSW 2 120,693,168 (GRCm39) missense probably benign 0.11
R4172:Ubr1 UTSW 2 120,777,103 (GRCm39) splice site probably null
R4173:Ubr1 UTSW 2 120,777,103 (GRCm39) splice site probably null
R4174:Ubr1 UTSW 2 120,777,103 (GRCm39) splice site probably null
R4241:Ubr1 UTSW 2 120,764,867 (GRCm39) missense possibly damaging 0.69
R4366:Ubr1 UTSW 2 120,801,084 (GRCm39) utr 5 prime probably benign
R4371:Ubr1 UTSW 2 120,725,547 (GRCm39) splice site probably null
R4449:Ubr1 UTSW 2 120,776,862 (GRCm39) missense possibly damaging 0.84
R4533:Ubr1 UTSW 2 120,772,963 (GRCm39) missense possibly damaging 0.86
R4656:Ubr1 UTSW 2 120,756,494 (GRCm39) missense probably benign 0.35
R4765:Ubr1 UTSW 2 120,793,923 (GRCm39) nonsense probably null
R4987:Ubr1 UTSW 2 120,794,047 (GRCm39) missense probably benign 0.00
R5033:Ubr1 UTSW 2 120,742,478 (GRCm39) critical splice donor site probably null
R5108:Ubr1 UTSW 2 120,793,903 (GRCm39) missense probably benign 0.20
R5118:Ubr1 UTSW 2 120,712,745 (GRCm39) missense probably benign 0.20
R5211:Ubr1 UTSW 2 120,723,651 (GRCm39) missense possibly damaging 0.92
R5215:Ubr1 UTSW 2 120,734,525 (GRCm39) missense probably benign 0.00
R5449:Ubr1 UTSW 2 120,793,981 (GRCm39) missense probably benign
R5452:Ubr1 UTSW 2 120,698,783 (GRCm39) missense possibly damaging 0.95
R5582:Ubr1 UTSW 2 120,745,888 (GRCm39) missense probably benign
R5610:Ubr1 UTSW 2 120,722,593 (GRCm39) missense probably benign 0.04
R5637:Ubr1 UTSW 2 120,793,998 (GRCm39) missense possibly damaging 0.68
R5808:Ubr1 UTSW 2 120,791,573 (GRCm39) missense possibly damaging 0.63
R5845:Ubr1 UTSW 2 120,734,486 (GRCm39) missense probably benign
R5979:Ubr1 UTSW 2 120,776,863 (GRCm39) missense probably benign 0.07
R6044:Ubr1 UTSW 2 120,693,202 (GRCm39) missense probably benign 0.38
R6146:Ubr1 UTSW 2 120,723,690 (GRCm39) missense probably damaging 0.98
R6252:Ubr1 UTSW 2 120,737,376 (GRCm39) missense probably benign 0.21
R6389:Ubr1 UTSW 2 120,711,520 (GRCm39) missense probably benign 0.03
R6600:Ubr1 UTSW 2 120,745,880 (GRCm39) missense probably benign 0.00
R6670:Ubr1 UTSW 2 120,754,611 (GRCm39) critical splice donor site probably null
R6731:Ubr1 UTSW 2 120,786,121 (GRCm39) missense probably null 0.99
R6836:Ubr1 UTSW 2 120,727,156 (GRCm39) splice site probably null
R6994:Ubr1 UTSW 2 120,794,074 (GRCm39) missense probably benign
R7121:Ubr1 UTSW 2 120,705,979 (GRCm39) missense probably benign 0.00
R7204:Ubr1 UTSW 2 120,734,558 (GRCm39) missense possibly damaging 0.49
R7209:Ubr1 UTSW 2 120,693,246 (GRCm39) missense probably benign 0.04
R7434:Ubr1 UTSW 2 120,693,161 (GRCm39) missense probably benign
R7457:Ubr1 UTSW 2 120,748,309 (GRCm39) missense probably benign 0.35
R7464:Ubr1 UTSW 2 120,720,255 (GRCm39) critical splice donor site probably null
R7519:Ubr1 UTSW 2 120,705,925 (GRCm39) missense possibly damaging 0.63
R7574:Ubr1 UTSW 2 120,703,672 (GRCm39) missense possibly damaging 0.93
R8030:Ubr1 UTSW 2 120,764,855 (GRCm39) missense probably damaging 0.99
R8085:Ubr1 UTSW 2 120,764,898 (GRCm39) nonsense probably null
R8221:Ubr1 UTSW 2 120,791,585 (GRCm39) missense probably damaging 0.97
R8241:Ubr1 UTSW 2 120,793,937 (GRCm39) missense possibly damaging 0.80
R8291:Ubr1 UTSW 2 120,741,596 (GRCm39) missense probably benign
R8293:Ubr1 UTSW 2 120,693,202 (GRCm39) missense probably benign 0.38
R8420:Ubr1 UTSW 2 120,701,476 (GRCm39) missense probably benign
R8489:Ubr1 UTSW 2 120,711,548 (GRCm39) missense probably benign 0.42
R8708:Ubr1 UTSW 2 120,696,964 (GRCm39) missense probably benign 0.27
R8856:Ubr1 UTSW 2 120,734,523 (GRCm39) missense probably damaging 1.00
R8995:Ubr1 UTSW 2 120,697,034 (GRCm39) missense probably damaging 1.00
R9153:Ubr1 UTSW 2 120,756,469 (GRCm39) missense probably benign 0.00
R9155:Ubr1 UTSW 2 120,754,615 (GRCm39) missense possibly damaging 0.84
R9156:Ubr1 UTSW 2 120,703,603 (GRCm39) critical splice donor site probably null
R9194:Ubr1 UTSW 2 120,778,325 (GRCm39) missense probably damaging 1.00
R9320:Ubr1 UTSW 2 120,727,000 (GRCm39) missense probably benign 0.04
R9401:Ubr1 UTSW 2 120,765,765 (GRCm39) missense probably benign 0.06
R9430:Ubr1 UTSW 2 120,734,506 (GRCm39) missense possibly damaging 0.59
R9515:Ubr1 UTSW 2 120,703,627 (GRCm39) missense probably damaging 1.00
R9623:Ubr1 UTSW 2 120,764,820 (GRCm39) missense probably benign 0.06
R9703:Ubr1 UTSW 2 120,732,092 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGAAGAAACTTGGGCCAC -3'
(R):5'- CCCTTGACATTGATGTTTTCAGTGC -3'

Sequencing Primer
(F):5'- GGGCCACAGATAAACTACTTTAATG -3'
(R):5'- ACATTGATGTTTTCAGTGCTTTGAAG -3'
Posted On 2016-04-15