Incidental Mutation 'R4928:Phc3'
ID380970
Institutional Source Beutler Lab
Gene Symbol Phc3
Ensembl Gene ENSMUSG00000037652
Gene Namepolyhomeotic 3
SynonymsHPH3, EDR3, E030046K01Rik
MMRRC Submission 042529-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4928 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location30899371-30969415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 30950919 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 175 (T175N)
Ref Sequence ENSEMBL: ENSMUSP00000037862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046624] [ENSMUST00000064718] [ENSMUST00000099163] [ENSMUST00000108255] [ENSMUST00000129817] [ENSMUST00000152357] [ENSMUST00000168645] [ENSMUST00000177992]
Predicted Effect probably damaging
Transcript: ENSMUST00000046624
AA Change: T175N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037862
Gene: ENSMUSG00000037652
AA Change: T175N

DomainStartEndE-ValueType
low complexity region 18 40 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 92 142 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
low complexity region 206 224 N/A INTRINSIC
low complexity region 333 359 N/A INTRINSIC
low complexity region 393 419 N/A INTRINSIC
low complexity region 512 538 N/A INTRINSIC
low complexity region 564 578 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000064718
AA Change: T175N

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000065617
Gene: ENSMUSG00000037652
AA Change: T175N

DomainStartEndE-ValueType
low complexity region 18 40 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 92 142 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
low complexity region 206 224 N/A INTRINSIC
low complexity region 333 359 N/A INTRINSIC
low complexity region 393 419 N/A INTRINSIC
low complexity region 470 496 N/A INTRINSIC
low complexity region 522 536 N/A INTRINSIC
low complexity region 541 571 N/A INTRINSIC
low complexity region 610 618 N/A INTRINSIC
low complexity region 628 656 N/A INTRINSIC
PDB:2L8E|A 745 781 1e-8 PDB
low complexity region 849 868 N/A INTRINSIC
SAM 884 951 4.04e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099163
AA Change: T175N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096767
Gene: ENSMUSG00000037652
AA Change: T175N

DomainStartEndE-ValueType
low complexity region 18 40 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 92 142 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
low complexity region 300 326 N/A INTRINSIC
low complexity region 360 386 N/A INTRINSIC
low complexity region 479 505 N/A INTRINSIC
low complexity region 531 545 N/A INTRINSIC
low complexity region 550 580 N/A INTRINSIC
low complexity region 619 627 N/A INTRINSIC
low complexity region 637 665 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108255
AA Change: T163N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103890
Gene: ENSMUSG00000037652
AA Change: T163N

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 80 130 N/A INTRINSIC
low complexity region 140 154 N/A INTRINSIC
low complexity region 288 314 N/A INTRINSIC
low complexity region 348 374 N/A INTRINSIC
low complexity region 467 493 N/A INTRINSIC
low complexity region 519 533 N/A INTRINSIC
low complexity region 538 568 N/A INTRINSIC
low complexity region 607 615 N/A INTRINSIC
low complexity region 625 653 N/A INTRINSIC
PDB:2L8E|A 742 778 8e-9 PDB
low complexity region 846 865 N/A INTRINSIC
SAM 881 948 4.04e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129817
AA Change: T163N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114916
Gene: ENSMUSG00000037652
AA Change: T163N

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 80 130 N/A INTRINSIC
low complexity region 140 154 N/A INTRINSIC
low complexity region 194 212 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
low complexity region 381 407 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
low complexity region 571 601 N/A INTRINSIC
low complexity region 640 648 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
PDB:2L8E|A 775 811 7e-9 PDB
low complexity region 879 898 N/A INTRINSIC
SAM 914 980 1.7e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152357
AA Change: T175N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117614
Gene: ENSMUSG00000037652
AA Change: T175N

DomainStartEndE-ValueType
low complexity region 18 40 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 92 142 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
low complexity region 201 222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168645
AA Change: T163N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130142
Gene: ENSMUSG00000037652
AA Change: T163N

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 80 130 N/A INTRINSIC
low complexity region 140 154 N/A INTRINSIC
low complexity region 194 212 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
low complexity region 381 407 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
low complexity region 571 601 N/A INTRINSIC
low complexity region 640 648 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
PDB:2L8E|A 775 811 7e-9 PDB
low complexity region 879 898 N/A INTRINSIC
SAM 914 980 1.6e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177992
AA Change: T163N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136820
Gene: ENSMUSG00000037652
AA Change: T163N

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 80 130 N/A INTRINSIC
low complexity region 140 154 N/A INTRINSIC
low complexity region 288 314 N/A INTRINSIC
low complexity region 348 374 N/A INTRINSIC
low complexity region 467 493 N/A INTRINSIC
low complexity region 519 533 N/A INTRINSIC
low complexity region 538 568 N/A INTRINSIC
low complexity region 607 615 N/A INTRINSIC
low complexity region 625 653 N/A INTRINSIC
PDB:2L8E|A 742 778 8e-9 PDB
low complexity region 846 865 N/A INTRINSIC
SAM 881 948 4.04e-13 SMART
Meta Mutation Damage Score 0.1518 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 98% (123/126)
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530021J07Rik G T 7: 83,155,878 noncoding transcript Het
Aasdh T A 5: 76,896,688 K118N possibly damaging Het
Abca14 A T 7: 120,324,580 N1620I possibly damaging Het
Acap1 A T 11: 69,885,815 S149T possibly damaging Het
Adgre1 T A 17: 57,444,064 Y579* probably null Het
AI314180 A G 4: 58,827,073 V1020A probably damaging Het
Aifm3 T C 16: 17,500,432 probably benign Het
Aldh16a1 A G 7: 45,141,961 W107R probably damaging Het
Amer2 A T 14: 60,379,445 H363L possibly damaging Het
Arhgap10 A G 8: 77,426,328 probably null Het
Arhgef6 A T X: 57,234,878 D742E probably damaging Het
Astn2 A T 4: 65,729,407 N731K probably damaging Het
Atp1a2 T C 1: 172,278,387 T904A possibly damaging Het
Atr C T 9: 95,907,299 R1503W probably damaging Het
Cdh3 G T 8: 106,536,610 R97L probably benign Het
Chst2 C T 9: 95,406,006 V96I probably benign Het
Cit T A 5: 115,985,797 N1464K probably benign Het
Col17a1 A T 19: 47,670,458 probably null Het
Col4a3 G A 1: 82,710,977 probably benign Het
Copz1 T A 15: 103,291,330 S57R probably damaging Het
Cpped1 A T 16: 11,828,279 F227Y probably damaging Het
Cyp2j12 A T 4: 96,102,151 probably null Het
Dctn1 T A 6: 83,189,207 I195N possibly damaging Het
Dhrs7b A G 11: 60,851,925 I148V probably benign Het
Dnah17 T C 11: 118,027,433 D4096G probably damaging Het
Dnajc13 T C 9: 104,233,638 N145D possibly damaging Het
Ercc6l2 T C 13: 63,894,813 probably benign Het
Fads6 T G 11: 115,296,561 I103L probably benign Het
Fam189a1 G T 7: 64,759,368 S426* probably null Het
Fat4 T G 3: 39,010,465 Y4857D probably damaging Het
Fbxl14 T A 6: 119,480,710 L284Q probably damaging Het
Fkbp9 T C 6: 56,849,670 V85A possibly damaging Het
Galnt13 T A 2: 54,516,565 V9E probably damaging Het
Gm14412 A T 2: 177,314,580 S507R probably benign Het
Gm15142 T A X: 154,638,419 noncoding transcript Het
Gm4787 T C 12: 81,378,838 E182G probably benign Het
Gm6811 C A 17: 21,094,631 noncoding transcript Het
Gm9791 A T 3: 34,005,069 noncoding transcript Het
Hoxb7 A T 11: 96,289,510 probably null Het
Ift122 T A 6: 115,915,858 probably benign Het
Krt28 C T 11: 99,374,632 V70I probably benign Het
Lig1 T C 7: 13,298,738 S459P probably damaging Het
Lrfn3 C T 7: 30,360,623 R59H possibly damaging Het
Mavs T C 2: 131,246,743 V489A probably benign Het
Mcm8 C T 2: 132,839,479 P625L probably benign Het
Megf10 G T 18: 57,240,673 R181L probably benign Het
Mgrn1 G A 16: 4,927,862 G440D probably benign Het
Mllt3 T C 4: 87,782,405 probably null Het
Muc5ac T A 7: 141,817,902 Y2613* probably null Het
Myh14 C T 7: 44,635,502 G662S probably benign Het
Myod1 T A 7: 46,377,050 N126K probably damaging Het
Nae1 A T 8: 104,516,142 H439Q possibly damaging Het
Narf T A 11: 121,244,939 V136E possibly damaging Het
Ncapd3 T A 9: 27,071,735 C926* probably null Het
Ndufv2 C A 17: 66,092,658 probably null Het
Neb T C 2: 52,212,975 S449G possibly damaging Het
Nek10 C T 14: 14,930,577 P698L probably damaging Het
Nox3 T A 17: 3,635,275 E566V probably null Het
Oas1a C T 5: 120,905,724 R115H probably benign Het
Olfr1076 T A 2: 86,509,125 L222H probably damaging Het
Olfr1130 C A 2: 87,608,143 L252I probably benign Het
Olfr1152 A G 2: 87,868,230 M80V probably benign Het
Olfr65 A G 7: 103,906,672 T78A probably damaging Het
Pbld2 A G 10: 63,047,999 H142R probably damaging Het
Pcdha4 C T 18: 36,954,816 T684M probably benign Het
Pigs G T 11: 78,329,002 V68L probably damaging Het
Pik3c2g T A 6: 139,967,802 D857E possibly damaging Het
Pitpnm3 G A 11: 72,063,172 P550S probably damaging Het
Pla2g15 G A 8: 106,163,218 W374* probably null Het
Ptpn14 G A 1: 189,822,642 C133Y probably damaging Het
Ptpn20 A G 14: 33,614,489 N95S probably benign Het
Ptrh2 G T 11: 86,690,036 V160F probably damaging Het
Rapgef3 T C 15: 97,757,375 D486G probably damaging Het
Rev3l T G 10: 39,823,985 S1493A probably benign Het
Rgs9 T A 11: 109,225,744 D411V probably benign Het
Rgsl1 A T 1: 153,793,768 Y291N probably damaging Het
Rprd2 A G 3: 95,764,537 Y1185H probably damaging Het
Rpusd3 A G 6: 113,416,206 probably benign Het
Scnn1a T C 6: 125,322,173 I72T probably damaging Het
Sdk1 A T 5: 141,857,003 probably benign Het
Sfmbt2 T C 2: 10,445,745 L277P probably benign Het
Sgf29 A G 7: 126,664,982 E73G probably damaging Het
Slc12a6 T A 2: 112,352,961 F764L probably damaging Het
Slc4a2 T C 5: 24,435,342 probably null Het
Slc9a3 T G 13: 74,157,719 V285G probably damaging Het
Slc9c1 A G 16: 45,575,409 T608A probably benign Het
Slfnl1 C T 4: 120,535,685 R325C probably damaging Het
Smarcad1 T A 6: 65,074,914 F344I probably benign Het
Snrnp70 A T 7: 45,377,281 probably null Het
Sod2 C T 17: 13,008,186 T9M probably benign Het
Spag5 T A 11: 78,314,373 S633T probably damaging Het
Spta1 A T 1: 174,191,056 I531L probably benign Het
Stra8 A G 6: 34,933,156 E60G probably benign Het
Sult2a3 T A 7: 14,111,557 I126F probably benign Het
Syt1 T C 10: 108,504,512 H315R possibly damaging Het
Tanc2 T C 11: 105,867,762 L783P probably damaging Het
Thbs2 C T 17: 14,678,900 C646Y probably damaging Het
Ticam2 T A 18: 46,560,922 K33* probably null Het
Trim17 T C 11: 58,954,301 probably benign Het
Tsr1 G A 11: 74,907,879 M691I probably benign Het
Ttn T A 2: 76,762,419 I20790F probably damaging Het
Tubb2b A T 13: 34,128,185 Y208* probably null Het
Ubr1 T A 2: 120,914,938 I890F probably damaging Het
Usp54 T C 14: 20,562,192 E852G probably damaging Het
Vmn2r78 T C 7: 86,954,627 V671A probably damaging Het
Wipi1 T C 11: 109,579,649 K315E probably benign Het
Xrn2 T C 2: 147,051,718 V735A possibly damaging Het
Zdbf2 T A 1: 63,308,814 D2117E possibly damaging Het
Zfp287 A T 11: 62,714,136 C648* probably null Het
Zfp369 A G 13: 65,296,800 T586A possibly damaging Het
Other mutations in Phc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Phc3 APN 3 30936475 missense probably damaging 0.98
IGL00985:Phc3 APN 3 30914197 missense probably benign 0.13
IGL01340:Phc3 APN 3 30929884 missense possibly damaging 0.85
IGL01450:Phc3 APN 3 30914504 missense probably damaging 1.00
IGL01546:Phc3 APN 3 30961739 missense probably damaging 1.00
IGL01918:Phc3 APN 3 30914416 critical splice donor site probably null
IGL02178:Phc3 APN 3 30929863 missense possibly damaging 0.47
IGL02210:Phc3 APN 3 30936709 missense probably damaging 0.99
IGL02330:Phc3 APN 3 30936381 missense probably damaging 1.00
IGL02516:Phc3 APN 3 30948793 missense probably damaging 1.00
IGL03030:Phc3 APN 3 30936853 missense probably damaging 1.00
See_saw UTSW 3 30937049 nonsense probably null
R1228:Phc3 UTSW 3 30922255 missense possibly damaging 0.71
R1239:Phc3 UTSW 3 30914130 missense probably damaging 1.00
R1319:Phc3 UTSW 3 30929869 missense probably damaging 0.97
R1521:Phc3 UTSW 3 30936575 missense possibly damaging 0.89
R1772:Phc3 UTSW 3 30961820 missense probably damaging 1.00
R1793:Phc3 UTSW 3 30948716 missense probably damaging 1.00
R1879:Phc3 UTSW 3 30914458 missense probably damaging 1.00
R2171:Phc3 UTSW 3 30950929 missense probably damaging 1.00
R2419:Phc3 UTSW 3 30950878 missense probably damaging 0.99
R2863:Phc3 UTSW 3 30914128 missense probably damaging 0.99
R2864:Phc3 UTSW 3 30914128 missense probably damaging 0.99
R3700:Phc3 UTSW 3 30914128 missense probably damaging 1.00
R3980:Phc3 UTSW 3 30936931 missense probably damaging 0.99
R4222:Phc3 UTSW 3 30936819 missense probably damaging 1.00
R4223:Phc3 UTSW 3 30936819 missense probably damaging 1.00
R4584:Phc3 UTSW 3 30965882 missense possibly damaging 0.46
R5100:Phc3 UTSW 3 30922199 missense possibly damaging 0.71
R5340:Phc3 UTSW 3 30907467 missense probably damaging 1.00
R5656:Phc3 UTSW 3 30965866 missense probably damaging 0.98
R5840:Phc3 UTSW 3 30936583 missense possibly damaging 0.95
R6022:Phc3 UTSW 3 30930025 missense probably damaging 1.00
R6061:Phc3 UTSW 3 30914529 missense probably damaging 1.00
R6177:Phc3 UTSW 3 30942565 missense probably damaging 1.00
R6188:Phc3 UTSW 3 30937049 nonsense probably null
R6866:Phc3 UTSW 3 30914531 nonsense probably null
R6870:Phc3 UTSW 3 30936761 missense probably damaging 1.00
R7155:Phc3 UTSW 3 30914197 missense probably benign 0.01
R7603:Phc3 UTSW 3 30907452 missense probably damaging 0.97
R7874:Phc3 UTSW 3 30936714 missense probably benign 0.00
R8422:Phc3 UTSW 3 30929890 nonsense probably null
R8877:Phc3 UTSW 3 30914122 missense probably damaging 1.00
X0025:Phc3 UTSW 3 30965886 missense probably damaging 0.96
Z1176:Phc3 UTSW 3 30936597 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCTAAGCATATGCACACACTTG -3'
(R):5'- TTGCCCACAGTAGAGGGTTC -3'

Sequencing Primer
(F):5'- GCATATGCACACACTTGTTAACTC -3'
(R):5'- AAGATCAGAGCCGCTCTTTG -3'
Posted On2016-04-15