Mutagenetix > Incidental Mutation

Incidental Mutation 'R4928:Astn2'

380975

Institutional Source

Beutler Lab

Gene Symbol

Astn2

Ensembl Gene

ENSMUSG00000028373

Gene Name

astrotactin 2

Synonyms

1d8, Astnl

MMRRC Submission

042529-MU

Accession Numbers

Genbank: NM _019514.3, NM _207109.2; Ensembl: ENSMUST 00000068214, ENSMUST 00000084496

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R4928 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65380803-66404611 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 65729407 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 731 (N731K)

Ref Sequence

ENSEMBL: ENSMUSP00000081540 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068214] [ENSMUST00000084496]

AlphaFold

Q80Z10

Predicted Effect

possibly damaging
Transcript: ENSMUST00000068214
AA Change: N783K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000065786
Gene: ENSMUSG00000028373
AA Change: N783K

Domain	Start	End	E-Value	Type
signal peptide	1	51	N/A	INTRINSIC
low complexity region	87	127	N/A	INTRINSIC
transmembrane domain	219	241	N/A	INTRINSIC
low complexity region	303	312	N/A	INTRINSIC
low complexity region	342	361	N/A	INTRINSIC
low complexity region	393	404	N/A	INTRINSIC
low complexity region	432	437	N/A	INTRINSIC
transmembrane domain	443	465	N/A	INTRINSIC
EGF_like	526	563	2.92e1	SMART
Blast:EGF_like	667	708	2e-18	BLAST
EGF_like	715	764	4.03e1	SMART
MACPF	864	1048	2.88e-55	SMART
FN3	1079	1191	2.41e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000084496
AA Change: N731K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000081540
Gene: ENSMUSG00000028373
AA Change: N731K

Domain	Start	End	E-Value	Type
signal peptide	1	51	N/A	INTRINSIC
low complexity region	87	127	N/A	INTRINSIC
transmembrane domain	219	241	N/A	INTRINSIC
low complexity region	303	312	N/A	INTRINSIC
low complexity region	341	352	N/A	INTRINSIC
low complexity region	380	385	N/A	INTRINSIC
transmembrane domain	391	413	N/A	INTRINSIC
EGF_like	474	511	2.92e1	SMART
Blast:EGF_like	615	656	2e-18	BLAST
EGF_like	663	712	4.03e1	SMART
MACPF	812	996	2.88e-55	SMART
FN3	1027	1139	2.41e0	SMART

Meta Mutation Damage Score

0.7604

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

98% (123/126)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is expressed in the brain and may function in neuronal migration, based on functional studies of the related astrotactin 1 gene in human and mouse. A deletion at this locus has been associated with schizophrenia. Multiple transcript variants encoding different proteins have been found for this locus. [provided by RefSeq, May 2010]

Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock

Total: 110 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530021J07Rik	G	T	7: 83,155,878		noncoding transcript	Het
Aasdh	T	A	5: 76,896,688	K118N	possibly damaging	Het
Abca14	A	T	7: 120,324,580	N1620I	possibly damaging	Het
Acap1	A	T	11: 69,885,815	S149T	possibly damaging	Het
Adgre1	T	A	17: 57,444,064	Y579*	probably null	Het
AI314180	A	G	4: 58,827,073	V1020A	probably damaging	Het
Aifm3	T	C	16: 17,500,432		probably benign	Het
Aldh16a1	A	G	7: 45,141,961	W107R	probably damaging	Het
Amer2	A	T	14: 60,379,445	H363L	possibly damaging	Het
Arhgap10	A	G	8: 77,426,328		probably null	Het
Arhgef6	A	T	X: 57,234,878	D742E	probably damaging	Het
Atp1a2	T	C	1: 172,278,387	T904A	possibly damaging	Het
Atr	C	T	9: 95,907,299	R1503W	probably damaging	Het
Cdh3	G	T	8: 106,536,610	R97L	probably benign	Het
Chst2	C	T	9: 95,406,006	V96I	probably benign	Het
Cit	T	A	5: 115,985,797	N1464K	probably benign	Het
Col17a1	A	T	19: 47,670,458		probably null	Het
Col4a3	G	A	1: 82,710,977		probably benign	Het
Copz1	T	A	15: 103,291,330	S57R	probably damaging	Het
Cpped1	A	T	16: 11,828,279	F227Y	probably damaging	Het
Cyp2j12	A	T	4: 96,102,151		probably null	Het
Dctn1	T	A	6: 83,189,207	I195N	possibly damaging	Het
Dhrs7b	A	G	11: 60,851,925	I148V	probably benign	Het
Dnah17	T	C	11: 118,027,433	D4096G	probably damaging	Het
Dnajc13	T	C	9: 104,233,638	N145D	possibly damaging	Het
Ercc6l2	T	C	13: 63,894,813		probably benign	Het
Fads6	T	G	11: 115,296,561	I103L	probably benign	Het
Fam189a1	G	T	7: 64,759,368	S426*	probably null	Het
Fat4	T	G	3: 39,010,465	Y4857D	probably damaging	Het
Fbxl14	T	A	6: 119,480,710	L284Q	probably damaging	Het
Fkbp9	T	C	6: 56,849,670	V85A	possibly damaging	Het
Galnt13	T	A	2: 54,516,565	V9E	probably damaging	Het
Gm14412	A	T	2: 177,314,580	S507R	probably benign	Het
Gm15142	T	A	X: 154,638,419		noncoding transcript	Het
Gm4787	T	C	12: 81,378,838	E182G	probably benign	Het
Gm6811	C	A	17: 21,094,631		noncoding transcript	Het
Gm9791	A	T	3: 34,005,069		noncoding transcript	Het
Hoxb7	A	T	11: 96,289,510		probably null	Het
Ift122	T	A	6: 115,915,858		probably benign	Het
Krt28	C	T	11: 99,374,632	V70I	probably benign	Het
Lig1	T	C	7: 13,298,738	S459P	probably damaging	Het
Lrfn3	C	T	7: 30,360,623	R59H	possibly damaging	Het
Mavs	T	C	2: 131,246,743	V489A	probably benign	Het
Mcm8	C	T	2: 132,839,479	P625L	probably benign	Het
Megf10	G	T	18: 57,240,673	R181L	probably benign	Het
Mgrn1	G	A	16: 4,927,862	G440D	probably benign	Het
Mllt3	T	C	4: 87,782,405		probably null	Het
Muc5ac	T	A	7: 141,817,902	Y2613*	probably null	Het
Myh14	C	T	7: 44,635,502	G662S	probably benign	Het
Myod1	T	A	7: 46,377,050	N126K	probably damaging	Het
Nae1	A	T	8: 104,516,142	H439Q	possibly damaging	Het
Narf	T	A	11: 121,244,939	V136E	possibly damaging	Het
Ncapd3	T	A	9: 27,071,735	C926*	probably null	Het
Ndufv2	C	A	17: 66,092,658		probably null	Het
Neb	T	C	2: 52,212,975	S449G	possibly damaging	Het
Nek10	C	T	14: 14,930,577	P698L	probably damaging	Het
Nox3	T	A	17: 3,635,275	E566V	probably null	Het
Oas1a	C	T	5: 120,905,724	R115H	probably benign	Het
Olfr1076	T	A	2: 86,509,125	L222H	probably damaging	Het
Olfr1130	C	A	2: 87,608,143	L252I	probably benign	Het
Olfr1152	A	G	2: 87,868,230	M80V	probably benign	Het
Olfr65	A	G	7: 103,906,672	T78A	probably damaging	Het
Pbld2	A	G	10: 63,047,999	H142R	probably damaging	Het
Pcdha4	C	T	18: 36,954,816	T684M	probably benign	Het
Phc3	G	T	3: 30,950,919	T175N	probably damaging	Het
Pigs	G	T	11: 78,329,002	V68L	probably damaging	Het
Pik3c2g	T	A	6: 139,967,802	D857E	possibly damaging	Het
Pitpnm3	G	A	11: 72,063,172	P550S	probably damaging	Het
Pla2g15	G	A	8: 106,163,218	W374*	probably null	Het
Ptpn14	G	A	1: 189,822,642	C133Y	probably damaging	Het
Ptpn20	A	G	14: 33,614,489	N95S	probably benign	Het
Ptrh2	G	T	11: 86,690,036	V160F	probably damaging	Het
Rapgef3	T	C	15: 97,757,375	D486G	probably damaging	Het
Rev3l	T	G	10: 39,823,985	S1493A	probably benign	Het
Rgs9	T	A	11: 109,225,744	D411V	probably benign	Het
Rgsl1	A	T	1: 153,793,768	Y291N	probably damaging	Het
Rprd2	A	G	3: 95,764,537	Y1185H	probably damaging	Het
Rpusd3	A	G	6: 113,416,206		probably benign	Het
Scnn1a	T	C	6: 125,322,173	I72T	probably damaging	Het
Sdk1	A	T	5: 141,857,003		probably benign	Het
Sfmbt2	T	C	2: 10,445,745	L277P	probably benign	Het
Sgf29	A	G	7: 126,664,982	E73G	probably damaging	Het
Slc12a6	T	A	2: 112,352,961	F764L	probably damaging	Het
Slc4a2	T	C	5: 24,435,342		probably null	Het
Slc9a3	T	G	13: 74,157,719	V285G	probably damaging	Het
Slc9c1	A	G	16: 45,575,409	T608A	probably benign	Het
Slfnl1	C	T	4: 120,535,685	R325C	probably damaging	Het
Smarcad1	T	A	6: 65,074,914	F344I	probably benign	Het
Snrnp70	A	T	7: 45,377,281		probably null	Het
Sod2	C	T	17: 13,008,186	T9M	probably benign	Het
Spag5	T	A	11: 78,314,373	S633T	probably damaging	Het
Spta1	A	T	1: 174,191,056	I531L	probably benign	Het
Stra8	A	G	6: 34,933,156	E60G	probably benign	Het
Sult2a3	T	A	7: 14,111,557	I126F	probably benign	Het
Syt1	T	C	10: 108,504,512	H315R	possibly damaging	Het
Tanc2	T	C	11: 105,867,762	L783P	probably damaging	Het
Thbs2	C	T	17: 14,678,900	C646Y	probably damaging	Het
Ticam2	T	A	18: 46,560,922	K33*	probably null	Het
Trim17	T	C	11: 58,954,301		probably benign	Het
Tsr1	G	A	11: 74,907,879	M691I	probably benign	Het
Ttn	T	A	2: 76,762,419	I20790F	probably damaging	Het
Tubb2b	A	T	13: 34,128,185	Y208*	probably null	Het
Ubr1	T	A	2: 120,914,938	I890F	probably damaging	Het
Usp54	T	C	14: 20,562,192	E852G	probably damaging	Het
Vmn2r78	T	C	7: 86,954,627	V671A	probably damaging	Het
Wipi1	T	C	11: 109,579,649	K315E	probably benign	Het
Xrn2	T	C	2: 147,051,718	V735A	possibly damaging	Het
Zdbf2	T	A	1: 63,308,814	D2117E	possibly damaging	Het
Zfp287	A	T	11: 62,714,136	C648*	probably null	Het
Zfp369	A	G	13: 65,296,800	T586A	possibly damaging	Het

Other mutations in Astn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00964:Astn2	APN	4	66185187	missense	unknown
IGL01657:Astn2	APN	4	65651949	missense	probably damaging	0.99
IGL01747:Astn2	APN	4	65794618	missense	probably benign	0.17
IGL02008:Astn2	APN	4	66059153	missense	probably damaging	1.00
IGL02215:Astn2	APN	4	66266234	missense	unknown
IGL02484:Astn2	APN	4	65992279	splice site	probably benign
IGL02494:Astn2	APN	4	65992348	missense	probably benign	0.23
IGL02792:Astn2	APN	4	65644821	missense	probably benign	0.32
IGL03248:Astn2	APN	4	65746293	splice site	probably benign
IGL03409:Astn2	APN	4	65435186	missense	possibly damaging	0.46
B6584:Astn2	UTSW	4	65992387	missense	probably damaging	0.99
R0015:Astn2	UTSW	4	66266382	critical splice acceptor site	probably null
R0015:Astn2	UTSW	4	66266382	critical splice acceptor site	probably null
R0092:Astn2	UTSW	4	66403982	missense	unknown
R0245:Astn2	UTSW	4	65794558	missense	probably damaging	0.99
R0528:Astn2	UTSW	4	65644882	splice site	probably benign
R0586:Astn2	UTSW	4	66185142	missense	unknown
R0652:Astn2	UTSW	4	65794558	missense	probably damaging	0.99
R0880:Astn2	UTSW	4	65648330	missense	probably damaging	0.99
R0931:Astn2	UTSW	4	65648293	missense	probably damaging	0.99
R1353:Astn2	UTSW	4	66266335	missense	unknown
R1700:Astn2	UTSW	4	65746354	nonsense	probably null
R1934:Astn2	UTSW	4	65435189	missense	probably damaging	0.99
R2017:Astn2	UTSW	4	65540941	missense	probably damaging	0.99
R2101:Astn2	UTSW	4	65581686	nonsense	probably null
R2158:Astn2	UTSW	4	66404254	missense	unknown
R2907:Astn2	UTSW	4	65644856	missense	possibly damaging	0.92
R2923:Astn2	UTSW	4	65913773	missense	probably damaging	1.00
R2938:Astn2	UTSW	4	65992313	missense	possibly damaging	0.92
R3033:Astn2	UTSW	4	65644706	missense	probably damaging	1.00
R3933:Astn2	UTSW	4	66403955	missense	unknown
R4151:Astn2	UTSW	4	65729320	critical splice donor site	probably null
R4230:Astn2	UTSW	4	65911682	missense	probably damaging	0.99
R4497:Astn2	UTSW	4	66119063	intron	probably benign
R4717:Astn2	UTSW	4	65644754	missense	possibly damaging	0.86
R4844:Astn2	UTSW	4	65644730	missense	possibly damaging	0.90
R5374:Astn2	UTSW	4	65397005	missense	probably damaging	0.96
R5442:Astn2	UTSW	4	65581786	missense	possibly damaging	0.86
R5694:Astn2	UTSW	4	65950138	missense	probably damaging	1.00
R5756:Astn2	UTSW	4	66119188	intron	probably benign
R5763:Astn2	UTSW	4	65729331	missense	probably benign	0.14
R6089:Astn2	UTSW	4	65794573	missense	probably damaging	0.96
R6990:Astn2	UTSW	4	65992303	missense	possibly damaging	0.82
R7304:Astn2	UTSW	4	66185375	missense	unknown
R7325:Astn2	UTSW	4	65542669	missense	probably benign	0.33
R7356:Astn2	UTSW	4	66185266	missense	unknown
R7414:Astn2	UTSW	4	65540956	missense	possibly damaging	0.85
R7755:Astn2	UTSW	4	65794558	missense	probably damaging	0.99
R7887:Astn2	UTSW	4	65644866	missense	possibly damaging	0.51
R8027:Astn2	UTSW	4	65540971	missense	possibly damaging	0.86
R8046:Astn2	UTSW	4	66266350	nonsense	probably null
R8188:Astn2	UTSW	4	66059181	missense	unknown
R8271:Astn2	UTSW	4	65992426	missense	unknown
R8274:Astn2	UTSW	4	65651861	critical splice donor site	probably null
R8505:Astn2	UTSW	4	65381588	missense	unknown
R8815:Astn2	UTSW	4	65912597	missense	possibly damaging	0.96
R8989:Astn2	UTSW	4	65581653	missense	possibly damaging	0.53
R9013:Astn2	UTSW	4	65992347	missense	probably benign	0.23
R9127:Astn2	UTSW	4	66403927	missense	unknown
R9255:Astn2	UTSW	4	65644848	nonsense	probably null
R9297:Astn2	UTSW	4	65542723	missense	possibly damaging	0.85
R9320:Astn2	UTSW	4	66404149	missense	unknown
R9349:Astn2	UTSW	4	66266255	missense	unknown
R9399:Astn2	UTSW	4	65746351	missense	possibly damaging	0.71
R9572:Astn2	UTSW	4	65381635	missense	unknown
R9573:Astn2	UTSW	4	65648354	missense	probably benign	0.08
R9674:Astn2	UTSW	4	65542726	missense	probably damaging	0.98
R9722:Astn2	UTSW	4	65913741	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- ACCCTGTGATGACTTCTAACTC -3'
(R):5'- AGAGCCTGGTTTTAGGTCAC -3'

Sequencing Primer
(F):5'- TCTCCGTGGAGAGTATTCAGCAAC -3'
(R):5'- AGCCTGGTTTTAGGTCACCTTCAG -3'

Posted On

2016-04-15