Incidental Mutation 'R4928:Slc4a2'
ID380980
Institutional Source Beutler Lab
Gene Symbol Slc4a2
Ensembl Gene ENSMUSG00000028962
Gene Namesolute carrier family 4 (anion exchanger), member 2
SynonymsB3RP, Ae2
MMRRC Submission 042529-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.514) question?
Stock #R4928 (G1)
Quality Score208
Status Validated
Chromosome5
Chromosomal Location24423837-24440950 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 24435342 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080067] [ENSMUST00000115043] [ENSMUST00000115047] [ENSMUST00000115049]
Predicted Effect probably null
Transcript: ENSMUST00000080067
SMART Domains Protein: ENSMUSP00000078972
Gene: ENSMUSG00000028962

DomainStartEndE-ValueType
low complexity region 93 110 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
low complexity region 138 151 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 296 313 N/A INTRINSIC
Pfam:Band_3_cyto 348 616 4.7e-111 PFAM
Pfam:HCO3_cotransp 671 1165 1.7e-217 PFAM
transmembrane domain 1183 1200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115043
SMART Domains Protein: ENSMUSP00000110695
Gene: ENSMUSG00000028959

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
Pfam:FAST_1 273 341 7.6e-24 PFAM
Pfam:FAST_2 349 440 6.9e-26 PFAM
Pfam:RAP 475 513 1.4e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115047
SMART Domains Protein: ENSMUSP00000110699
Gene: ENSMUSG00000028962

DomainStartEndE-ValueType
low complexity region 79 96 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
low complexity region 124 137 N/A INTRINSIC
low complexity region 155 164 N/A INTRINSIC
low complexity region 186 202 N/A INTRINSIC
low complexity region 282 299 N/A INTRINSIC
Pfam:Band_3_cyto 334 602 7.2e-108 PFAM
Pfam:HCO3_cotransp 656 1151 1e-244 PFAM
transmembrane domain 1169 1186 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115049
SMART Domains Protein: ENSMUSP00000110701
Gene: ENSMUSG00000028962

DomainStartEndE-ValueType
low complexity region 84 101 N/A INTRINSIC
low complexity region 103 126 N/A INTRINSIC
low complexity region 129 142 N/A INTRINSIC
low complexity region 160 169 N/A INTRINSIC
low complexity region 191 207 N/A INTRINSIC
low complexity region 287 304 N/A INTRINSIC
Pfam:Band_3_cyto 339 607 7.3e-108 PFAM
Pfam:HCO3_cotransp 661 1156 1e-244 PFAM
transmembrane domain 1174 1191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198786
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 98% (123/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the anion exchanger family of membrane transport proteins. The encoded protein regulates intracellular pH, biliary bicarbonate secretion, and chloride uptake. Reduced expression of this gene may be associated with primary biliary cirrhosis (PBC) in human patients, while differential expression of this gene may be associated with malignant hepatocellular carcinoma, colon and gastric cancers. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice carrying an isoform-specific allele display male infertility associated with disrupted spermiogenesis and germ cell apoptosis. Mice homozygous for a null allele display perinatal and postnatal lethality, loss of gastric acid secretion, failure of tooth eruption, aphagia, and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530021J07Rik G T 7: 83,155,878 noncoding transcript Het
Aasdh T A 5: 76,896,688 K118N possibly damaging Het
Abca14 A T 7: 120,324,580 N1620I possibly damaging Het
Acap1 A T 11: 69,885,815 S149T possibly damaging Het
Adgre1 T A 17: 57,444,064 Y579* probably null Het
AI314180 A G 4: 58,827,073 V1020A probably damaging Het
Aifm3 T C 16: 17,500,432 probably benign Het
Aldh16a1 A G 7: 45,141,961 W107R probably damaging Het
Amer2 A T 14: 60,379,445 H363L possibly damaging Het
Arhgap10 A G 8: 77,426,328 probably null Het
Arhgef6 A T X: 57,234,878 D742E probably damaging Het
Astn2 A T 4: 65,729,407 N731K probably damaging Het
Atp1a2 T C 1: 172,278,387 T904A possibly damaging Het
Atr C T 9: 95,907,299 R1503W probably damaging Het
Cdh3 G T 8: 106,536,610 R97L probably benign Het
Chst2 C T 9: 95,406,006 V96I probably benign Het
Cit T A 5: 115,985,797 N1464K probably benign Het
Col17a1 A T 19: 47,670,458 probably null Het
Col4a3 G A 1: 82,710,977 probably benign Het
Copz1 T A 15: 103,291,330 S57R probably damaging Het
Cpped1 A T 16: 11,828,279 F227Y probably damaging Het
Cyp2j12 A T 4: 96,102,151 probably null Het
Dctn1 T A 6: 83,189,207 I195N possibly damaging Het
Dhrs7b A G 11: 60,851,925 I148V probably benign Het
Dnah17 T C 11: 118,027,433 D4096G probably damaging Het
Dnajc13 T C 9: 104,233,638 N145D possibly damaging Het
Ercc6l2 T C 13: 63,894,813 probably benign Het
Fads6 T G 11: 115,296,561 I103L probably benign Het
Fam189a1 G T 7: 64,759,368 S426* probably null Het
Fat4 T G 3: 39,010,465 Y4857D probably damaging Het
Fbxl14 T A 6: 119,480,710 L284Q probably damaging Het
Fkbp9 T C 6: 56,849,670 V85A possibly damaging Het
Galnt13 T A 2: 54,516,565 V9E probably damaging Het
Gm14412 A T 2: 177,314,580 S507R probably benign Het
Gm15142 T A X: 154,638,419 noncoding transcript Het
Gm4787 T C 12: 81,378,838 E182G probably benign Het
Gm6811 C A 17: 21,094,631 noncoding transcript Het
Gm9791 A T 3: 34,005,069 noncoding transcript Het
Hoxb7 A T 11: 96,289,510 probably null Het
Ift122 T A 6: 115,915,858 probably benign Het
Krt28 C T 11: 99,374,632 V70I probably benign Het
Lig1 T C 7: 13,298,738 S459P probably damaging Het
Lrfn3 C T 7: 30,360,623 R59H possibly damaging Het
Mavs T C 2: 131,246,743 V489A probably benign Het
Mcm8 C T 2: 132,839,479 P625L probably benign Het
Megf10 G T 18: 57,240,673 R181L probably benign Het
Mgrn1 G A 16: 4,927,862 G440D probably benign Het
Mllt3 T C 4: 87,782,405 probably null Het
Muc5ac T A 7: 141,817,902 Y2613* probably null Het
Myh14 C T 7: 44,635,502 G662S probably benign Het
Myod1 T A 7: 46,377,050 N126K probably damaging Het
Nae1 A T 8: 104,516,142 H439Q possibly damaging Het
Narf T A 11: 121,244,939 V136E possibly damaging Het
Ncapd3 T A 9: 27,071,735 C926* probably null Het
Ndufv2 C A 17: 66,092,658 probably null Het
Neb T C 2: 52,212,975 S449G possibly damaging Het
Nek10 C T 14: 14,930,577 P698L probably damaging Het
Nox3 T A 17: 3,635,275 E566V probably null Het
Oas1a C T 5: 120,905,724 R115H probably benign Het
Olfr1076 T A 2: 86,509,125 L222H probably damaging Het
Olfr1130 C A 2: 87,608,143 L252I probably benign Het
Olfr1152 A G 2: 87,868,230 M80V probably benign Het
Olfr65 A G 7: 103,906,672 T78A probably damaging Het
Pbld2 A G 10: 63,047,999 H142R probably damaging Het
Pcdha4 C T 18: 36,954,816 T684M probably benign Het
Phc3 G T 3: 30,950,919 T175N probably damaging Het
Pigs G T 11: 78,329,002 V68L probably damaging Het
Pik3c2g T A 6: 139,967,802 D857E possibly damaging Het
Pitpnm3 G A 11: 72,063,172 P550S probably damaging Het
Pla2g15 G A 8: 106,163,218 W374* probably null Het
Ptpn14 G A 1: 189,822,642 C133Y probably damaging Het
Ptpn20 A G 14: 33,614,489 N95S probably benign Het
Ptrh2 G T 11: 86,690,036 V160F probably damaging Het
Rapgef3 T C 15: 97,757,375 D486G probably damaging Het
Rev3l T G 10: 39,823,985 S1493A probably benign Het
Rgs9 T A 11: 109,225,744 D411V probably benign Het
Rgsl1 A T 1: 153,793,768 Y291N probably damaging Het
Rprd2 A G 3: 95,764,537 Y1185H probably damaging Het
Rpusd3 A G 6: 113,416,206 probably benign Het
Scnn1a T C 6: 125,322,173 I72T probably damaging Het
Sdk1 A T 5: 141,857,003 probably benign Het
Sfmbt2 T C 2: 10,445,745 L277P probably benign Het
Sgf29 A G 7: 126,664,982 E73G probably damaging Het
Slc12a6 T A 2: 112,352,961 F764L probably damaging Het
Slc9a3 T G 13: 74,157,719 V285G probably damaging Het
Slc9c1 A G 16: 45,575,409 T608A probably benign Het
Slfnl1 C T 4: 120,535,685 R325C probably damaging Het
Smarcad1 T A 6: 65,074,914 F344I probably benign Het
Snrnp70 A T 7: 45,377,281 probably null Het
Sod2 C T 17: 13,008,186 T9M probably benign Het
Spag5 T A 11: 78,314,373 S633T probably damaging Het
Spta1 A T 1: 174,191,056 I531L probably benign Het
Stra8 A G 6: 34,933,156 E60G probably benign Het
Sult2a3 T A 7: 14,111,557 I126F probably benign Het
Syt1 T C 10: 108,504,512 H315R possibly damaging Het
Tanc2 T C 11: 105,867,762 L783P probably damaging Het
Thbs2 C T 17: 14,678,900 C646Y probably damaging Het
Ticam2 T A 18: 46,560,922 K33* probably null Het
Trim17 T C 11: 58,954,301 probably benign Het
Tsr1 G A 11: 74,907,879 M691I probably benign Het
Ttn T A 2: 76,762,419 I20790F probably damaging Het
Tubb2b A T 13: 34,128,185 Y208* probably null Het
Ubr1 T A 2: 120,914,938 I890F probably damaging Het
Usp54 T C 14: 20,562,192 E852G probably damaging Het
Vmn2r78 T C 7: 86,954,627 V671A probably damaging Het
Wipi1 T C 11: 109,579,649 K315E probably benign Het
Xrn2 T C 2: 147,051,718 V735A possibly damaging Het
Zdbf2 T A 1: 63,308,814 D2117E possibly damaging Het
Zfp287 A T 11: 62,714,136 C648* probably null Het
Zfp369 A G 13: 65,296,800 T586A possibly damaging Het
Other mutations in Slc4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Slc4a2 APN 5 24439068 missense probably damaging 1.00
IGL00772:Slc4a2 APN 5 24435196 missense probably damaging 1.00
IGL00897:Slc4a2 APN 5 24429559 nonsense probably null
IGL01477:Slc4a2 APN 5 24430156 unclassified probably benign
IGL01680:Slc4a2 APN 5 24432930 missense probably benign 0.23
IGL01681:Slc4a2 APN 5 24434187 missense probably damaging 1.00
IGL01808:Slc4a2 APN 5 24440207 missense probably damaging 1.00
IGL02399:Slc4a2 APN 5 24434713 missense probably damaging 1.00
IGL02501:Slc4a2 APN 5 24429434 missense probably benign 0.00
IGL03214:Slc4a2 APN 5 24434881 missense probably benign 0.01
R0238:Slc4a2 UTSW 5 24436274 splice site probably null
R0238:Slc4a2 UTSW 5 24436274 splice site probably null
R0309:Slc4a2 UTSW 5 24434346 missense probably damaging 1.00
R0325:Slc4a2 UTSW 5 24435943 missense probably damaging 1.00
R0656:Slc4a2 UTSW 5 24431259 missense probably benign 0.05
R0755:Slc4a2 UTSW 5 24435577 missense probably benign 0.07
R0946:Slc4a2 UTSW 5 24435886 missense probably damaging 1.00
R1075:Slc4a2 UTSW 5 24439057 missense possibly damaging 0.85
R1733:Slc4a2 UTSW 5 24429567 missense probably damaging 1.00
R1794:Slc4a2 UTSW 5 24439328 missense probably damaging 1.00
R1823:Slc4a2 UTSW 5 24427620 missense probably damaging 0.99
R2048:Slc4a2 UTSW 5 24431559 missense probably damaging 1.00
R2165:Slc4a2 UTSW 5 24431316 missense probably damaging 1.00
R2181:Slc4a2 UTSW 5 24435653 missense possibly damaging 0.80
R2405:Slc4a2 UTSW 5 24435601 missense probably damaging 1.00
R3551:Slc4a2 UTSW 5 24430101 missense probably benign 0.01
R4423:Slc4a2 UTSW 5 24439848 nonsense probably null
R4457:Slc4a2 UTSW 5 24434330 unclassified probably benign
R4678:Slc4a2 UTSW 5 24434240 critical splice donor site probably null
R4730:Slc4a2 UTSW 5 24434880 missense probably damaging 1.00
R4824:Slc4a2 UTSW 5 24440143 missense probably damaging 1.00
R4993:Slc4a2 UTSW 5 24434869 missense probably damaging 1.00
R5071:Slc4a2 UTSW 5 24438762 missense probably benign
R5072:Slc4a2 UTSW 5 24438762 missense probably benign
R5073:Slc4a2 UTSW 5 24438762 missense probably benign
R5074:Slc4a2 UTSW 5 24438762 missense probably benign
R5108:Slc4a2 UTSW 5 24439333 missense probably damaging 1.00
R5135:Slc4a2 UTSW 5 24430127 missense possibly damaging 0.78
R5349:Slc4a2 UTSW 5 24435635 missense possibly damaging 0.74
R5601:Slc4a2 UTSW 5 24438774 missense probably benign 0.07
R5666:Slc4a2 UTSW 5 24434838 missense probably damaging 1.00
R5670:Slc4a2 UTSW 5 24434838 missense probably damaging 1.00
R6256:Slc4a2 UTSW 5 24435890 missense probably damaging 1.00
R6861:Slc4a2 UTSW 5 24435009 missense probably damaging 1.00
R7360:Slc4a2 UTSW 5 24429715 missense probably benign 0.11
R7494:Slc4a2 UTSW 5 24432864 missense possibly damaging 0.91
R7740:Slc4a2 UTSW 5 24431668 splice site probably null
R8087:Slc4a2 UTSW 5 24438749 unclassified probably benign
X0027:Slc4a2 UTSW 5 24435914 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGCTATCAATGCCTTCCTGGAC -3'
(R):5'- ACCTCTACCATCTGCAGGAG -3'

Sequencing Primer
(F):5'- AATGCCTTCCTGGACTGCAG -3'
(R):5'- AGTGCTGCAATCCAGGC -3'
Posted On2016-04-15