Incidental Mutation 'R4928:Cit'
ID 380981
Institutional Source Beutler Lab
Gene Symbol Cit
Ensembl Gene ENSMUSG00000029516
Gene Name citron
Synonyms CRIK-SK, C030025P15Rik, citron kinase, Cit-k, citron-N
MMRRC Submission 042529-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R4928 (G1)
Quality Score 124
Status Validated
Chromosome 5
Chromosomal Location 115983337-116147006 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 116123856 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1464 (N1464K)
Ref Sequence ENSEMBL: ENSMUSP00000115802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051704] [ENSMUST00000102560] [ENSMUST00000112008] [ENSMUST00000141101]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000051704
AA Change: N1506K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062049
Gene: ENSMUSG00000029516
AA Change: N1506K

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 891 905 N/A INTRINSIC
low complexity region 915 948 N/A INTRINSIC
low complexity region 950 968 N/A INTRINSIC
low complexity region 1068 1081 N/A INTRINSIC
low complexity region 1138 1156 N/A INTRINSIC
low complexity region 1182 1203 N/A INTRINSIC
internal_repeat_1 1243 1282 1.05e-5 PROSPERO
low complexity region 1353 1364 N/A INTRINSIC
C1 1389 1437 1.97e-9 SMART
PH 1470 1591 1.31e-8 SMART
CNH 1618 1915 1.78e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102560
AA Change: N1521K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099620
Gene: ENSMUSG00000029516
AA Change: N1521K

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1244 N/A INTRINSIC
coiled coil region 1297 1338 N/A INTRINSIC
low complexity region 1368 1379 N/A INTRINSIC
C1 1404 1452 1.97e-9 SMART
PH 1485 1606 1.31e-8 SMART
CNH 1633 1930 1.78e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112008
AA Change: N1479K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107639
Gene: ENSMUSG00000029516
AA Change: N1479K

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1202 N/A INTRINSIC
coiled coil region 1255 1296 N/A INTRINSIC
low complexity region 1326 1337 N/A INTRINSIC
C1 1362 1410 1.97e-9 SMART
PH 1443 1564 1.31e-8 SMART
CNH 1591 1888 1.78e-112 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122877
Predicted Effect probably benign
Transcript: ENSMUST00000123736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134609
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145363
Predicted Effect probably benign
Transcript: ENSMUST00000141101
AA Change: N1464K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115802
Gene: ENSMUSG00000029516
AA Change: N1464K

DomainStartEndE-ValueType
S_TKc 97 359 1.4e-91 SMART
S_TK_X 360 422 3e-18 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 686 698 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 873 906 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
low complexity region 1026 1039 N/A INTRINSIC
low complexity region 1096 1114 N/A INTRINSIC
low complexity region 1140 1161 N/A INTRINSIC
internal_repeat_1 1201 1240 1.73e-5 PROSPERO
low complexity region 1311 1322 N/A INTRINSIC
C1 1347 1395 9.7e-12 SMART
PH 1428 1549 6e-11 SMART
CNH 1576 1873 8.6e-115 SMART
Meta Mutation Damage Score 0.0863 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 98% (123/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null mutation are 20% smaller than wild-type and exhibit tremors, ataxia, and fatal seizures. Brains of mutant mice show a 50% size reduction with abnormalities in the hippocampus, cerebellum, and olfactory lobes. Mutant males show aberrant cytokinesis of spermatogenic precursors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530021J07Rik G T 7: 82,805,086 (GRCm39) noncoding transcript Het
Aasdh T A 5: 77,044,535 (GRCm39) K118N possibly damaging Het
Abca14 A T 7: 119,923,803 (GRCm39) N1620I possibly damaging Het
Acap1 A T 11: 69,776,641 (GRCm39) S149T possibly damaging Het
Adgre1 T A 17: 57,751,064 (GRCm39) Y579* probably null Het
Aifm3 T C 16: 17,318,296 (GRCm39) probably benign Het
Aldh16a1 A G 7: 44,791,385 (GRCm39) W107R probably damaging Het
Amer2 A T 14: 60,616,894 (GRCm39) H363L possibly damaging Het
Arhgap10 A G 8: 78,152,957 (GRCm39) probably null Het
Arhgef6 A T X: 56,280,238 (GRCm39) D742E probably damaging Het
Astn2 A T 4: 65,647,644 (GRCm39) N731K probably damaging Het
Atp1a2 T C 1: 172,105,954 (GRCm39) T904A possibly damaging Het
Atr C T 9: 95,789,352 (GRCm39) R1503W probably damaging Het
Cdh3 G T 8: 107,263,242 (GRCm39) R97L probably benign Het
Chst2 C T 9: 95,288,059 (GRCm39) V96I probably benign Het
Col17a1 A T 19: 47,658,897 (GRCm39) probably null Het
Col4a3 G A 1: 82,688,698 (GRCm39) probably benign Het
Copz1 T A 15: 103,199,757 (GRCm39) S57R probably damaging Het
Cpped1 A T 16: 11,646,143 (GRCm39) F227Y probably damaging Het
Cyp2j12 A T 4: 95,990,388 (GRCm39) probably null Het
Dctn1 T A 6: 83,166,189 (GRCm39) I195N possibly damaging Het
Dhrs7b A G 11: 60,742,751 (GRCm39) I148V probably benign Het
Dnah17 T C 11: 117,918,259 (GRCm39) D4096G probably damaging Het
Dnajc13 T C 9: 104,110,837 (GRCm39) N145D possibly damaging Het
Ecpas A G 4: 58,827,073 (GRCm39) V1020A probably damaging Het
Entrep2 G T 7: 64,409,116 (GRCm39) S426* probably null Het
Ercc6l2 T C 13: 64,042,627 (GRCm39) probably benign Het
Fads6 T G 11: 115,187,387 (GRCm39) I103L probably benign Het
Fat4 T G 3: 39,064,614 (GRCm39) Y4857D probably damaging Het
Fbxl14 T A 6: 119,457,671 (GRCm39) L284Q probably damaging Het
Fkbp9 T C 6: 56,826,655 (GRCm39) V85A possibly damaging Het
Galnt13 T A 2: 54,406,577 (GRCm39) V9E probably damaging Het
Gm14412 A T 2: 177,006,373 (GRCm39) S507R probably benign Het
Gm15142 T A X: 153,421,415 (GRCm39) noncoding transcript Het
Gm4787 T C 12: 81,425,612 (GRCm39) E182G probably benign Het
Gm6811 C A 17: 21,314,893 (GRCm39) noncoding transcript Het
Gm9791 A T 3: 34,059,218 (GRCm39) noncoding transcript Het
Hoxb7 A T 11: 96,180,336 (GRCm39) probably null Het
Ift122 T A 6: 115,892,819 (GRCm39) probably benign Het
Krt28 C T 11: 99,265,458 (GRCm39) V70I probably benign Het
Lig1 T C 7: 13,032,664 (GRCm39) S459P probably damaging Het
Lrfn3 C T 7: 30,060,048 (GRCm39) R59H possibly damaging Het
Mavs T C 2: 131,088,663 (GRCm39) V489A probably benign Het
Mcm8 C T 2: 132,681,399 (GRCm39) P625L probably benign Het
Megf10 G T 18: 57,373,745 (GRCm39) R181L probably benign Het
Mgrn1 G A 16: 4,745,726 (GRCm39) G440D probably benign Het
Mllt3 T C 4: 87,700,642 (GRCm39) probably null Het
Muc5ac T A 7: 141,371,639 (GRCm39) Y2613* probably null Het
Myh14 C T 7: 44,284,926 (GRCm39) G662S probably benign Het
Myod1 T A 7: 46,026,474 (GRCm39) N126K probably damaging Het
Nae1 A T 8: 105,242,774 (GRCm39) H439Q possibly damaging Het
Narf T A 11: 121,135,765 (GRCm39) V136E possibly damaging Het
Ncapd3 T A 9: 26,983,031 (GRCm39) C926* probably null Het
Ndufv2 C A 17: 66,399,653 (GRCm39) probably null Het
Neb T C 2: 52,102,987 (GRCm39) S449G possibly damaging Het
Nek10 C T 14: 14,930,577 (GRCm38) P698L probably damaging Het
Nox3 T A 17: 3,685,550 (GRCm39) E566V probably null Het
Oas1a C T 5: 121,043,787 (GRCm39) R115H probably benign Het
Or10ag60 C A 2: 87,438,487 (GRCm39) L252I probably benign Het
Or51b6 A G 7: 103,555,879 (GRCm39) T78A probably damaging Het
Or5w19 A G 2: 87,698,574 (GRCm39) M80V probably benign Het
Or8k30 T A 2: 86,339,469 (GRCm39) L222H probably damaging Het
Pbld2 A G 10: 62,883,778 (GRCm39) H142R probably damaging Het
Pcdha4 C T 18: 37,087,869 (GRCm39) T684M probably benign Het
Phc3 G T 3: 31,005,068 (GRCm39) T175N probably damaging Het
Pigs G T 11: 78,219,828 (GRCm39) V68L probably damaging Het
Pik3c2g T A 6: 139,913,528 (GRCm39) D857E possibly damaging Het
Pitpnm3 G A 11: 71,953,998 (GRCm39) P550S probably damaging Het
Pla2g15 G A 8: 106,889,850 (GRCm39) W374* probably null Het
Ptpn14 G A 1: 189,554,839 (GRCm39) C133Y probably damaging Het
Ptpn20 A G 14: 33,336,446 (GRCm39) N95S probably benign Het
Ptrh2 G T 11: 86,580,862 (GRCm39) V160F probably damaging Het
Rapgef3 T C 15: 97,655,256 (GRCm39) D486G probably damaging Het
Rev3l T G 10: 39,699,981 (GRCm39) S1493A probably benign Het
Rgs9 T A 11: 109,116,570 (GRCm39) D411V probably benign Het
Rgsl1 A T 1: 153,669,514 (GRCm39) Y291N probably damaging Het
Rprd2 A G 3: 95,671,849 (GRCm39) Y1185H probably damaging Het
Rpusd3 A G 6: 113,393,167 (GRCm39) probably benign Het
Scnn1a T C 6: 125,299,136 (GRCm39) I72T probably damaging Het
Sdk1 A T 5: 141,842,758 (GRCm39) probably benign Het
Sfmbt2 T C 2: 10,450,556 (GRCm39) L277P probably benign Het
Sgf29 A G 7: 126,264,154 (GRCm39) E73G probably damaging Het
Slc12a6 T A 2: 112,183,306 (GRCm39) F764L probably damaging Het
Slc4a2 T C 5: 24,640,340 (GRCm39) probably null Het
Slc9a3 T G 13: 74,305,838 (GRCm39) V285G probably damaging Het
Slc9c1 A G 16: 45,395,772 (GRCm39) T608A probably benign Het
Slfnl1 C T 4: 120,392,882 (GRCm39) R325C probably damaging Het
Smarcad1 T A 6: 65,051,898 (GRCm39) F344I probably benign Het
Snrnp70 A T 7: 45,026,705 (GRCm39) probably null Het
Sod2 C T 17: 13,227,073 (GRCm39) T9M probably benign Het
Spag5 T A 11: 78,205,199 (GRCm39) S633T probably damaging Het
Spta1 A T 1: 174,018,622 (GRCm39) I531L probably benign Het
Stra8 A G 6: 34,910,091 (GRCm39) E60G probably benign Het
Sult2a3 T A 7: 13,845,482 (GRCm39) I126F probably benign Het
Syt1 T C 10: 108,340,373 (GRCm39) H315R possibly damaging Het
Tanc2 T C 11: 105,758,588 (GRCm39) L783P probably damaging Het
Thbs2 C T 17: 14,899,162 (GRCm39) C646Y probably damaging Het
Ticam2 T A 18: 46,693,989 (GRCm39) K33* probably null Het
Trim17 T C 11: 58,845,127 (GRCm39) probably benign Het
Tsr1 G A 11: 74,798,705 (GRCm39) M691I probably benign Het
Ttn T A 2: 76,592,763 (GRCm39) I20790F probably damaging Het
Tubb2b A T 13: 34,312,168 (GRCm39) Y208* probably null Het
Ubr1 T A 2: 120,745,419 (GRCm39) I890F probably damaging Het
Usp54 T C 14: 20,612,260 (GRCm39) E852G probably damaging Het
Vmn2r78 T C 7: 86,603,835 (GRCm39) V671A probably damaging Het
Wipi1 T C 11: 109,470,475 (GRCm39) K315E probably benign Het
Xrn2 T C 2: 146,893,638 (GRCm39) V735A possibly damaging Het
Zdbf2 T A 1: 63,347,973 (GRCm39) D2117E possibly damaging Het
Zfp287 A T 11: 62,604,962 (GRCm39) C648* probably null Het
Zfp369 A G 13: 65,444,614 (GRCm39) T586A possibly damaging Het
Other mutations in Cit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Cit APN 5 115,984,524 (GRCm39) missense probably damaging 0.99
IGL00482:Cit APN 5 116,076,814 (GRCm39) missense probably damaging 0.97
IGL01317:Cit APN 5 116,046,775 (GRCm39) missense probably benign 0.03
IGL01335:Cit APN 5 116,046,889 (GRCm39) splice site probably benign
IGL01415:Cit APN 5 116,079,962 (GRCm39) missense possibly damaging 0.78
IGL01447:Cit APN 5 116,011,902 (GRCm39) splice site probably benign
IGL01537:Cit APN 5 116,071,913 (GRCm39) missense probably benign 0.00
IGL01621:Cit APN 5 116,130,662 (GRCm39) splice site probably benign
IGL02010:Cit APN 5 116,014,006 (GRCm39) missense probably damaging 1.00
IGL02538:Cit APN 5 116,125,048 (GRCm39) nonsense probably null
IGL02607:Cit APN 5 115,997,268 (GRCm39) missense probably benign
IGL02720:Cit APN 5 116,133,511 (GRCm39) missense probably benign 0.26
IGL02725:Cit APN 5 116,123,532 (GRCm39) missense probably benign 0.02
IGL02967:Cit APN 5 116,083,896 (GRCm39) missense probably benign 0.11
IGL02973:Cit APN 5 116,144,058 (GRCm39) missense possibly damaging 0.73
IGL03383:Cit APN 5 116,011,904 (GRCm39) splice site probably benign
PIT4514001:Cit UTSW 5 116,135,913 (GRCm39) critical splice donor site probably null
R0206:Cit UTSW 5 116,132,089 (GRCm39) missense possibly damaging 0.72
R0206:Cit UTSW 5 116,132,089 (GRCm39) missense possibly damaging 0.72
R0226:Cit UTSW 5 116,122,899 (GRCm39) missense probably damaging 0.99
R0320:Cit UTSW 5 116,117,504 (GRCm39) missense possibly damaging 0.87
R0401:Cit UTSW 5 116,123,538 (GRCm39) missense probably benign 0.06
R0480:Cit UTSW 5 116,071,452 (GRCm39) splice site probably benign
R0609:Cit UTSW 5 116,012,002 (GRCm39) missense probably damaging 0.98
R0737:Cit UTSW 5 116,084,978 (GRCm39) missense probably damaging 1.00
R1238:Cit UTSW 5 115,989,280 (GRCm39) missense probably benign 0.30
R1503:Cit UTSW 5 116,011,959 (GRCm39) missense possibly damaging 0.94
R1551:Cit UTSW 5 116,083,901 (GRCm39) missense probably benign 0.00
R1602:Cit UTSW 5 116,135,789 (GRCm39) missense probably damaging 1.00
R1720:Cit UTSW 5 116,105,956 (GRCm39) missense probably damaging 0.98
R1854:Cit UTSW 5 116,011,960 (GRCm39) missense probably damaging 1.00
R1886:Cit UTSW 5 116,071,545 (GRCm39) missense probably damaging 1.00
R2024:Cit UTSW 5 116,143,899 (GRCm39) missense probably damaging 0.97
R2024:Cit UTSW 5 116,085,983 (GRCm39) missense probably damaging 0.97
R2048:Cit UTSW 5 116,024,872 (GRCm39) splice site probably null
R2128:Cit UTSW 5 116,123,566 (GRCm39) missense possibly damaging 0.63
R2192:Cit UTSW 5 116,106,068 (GRCm39) missense probably benign 0.00
R2244:Cit UTSW 5 116,064,564 (GRCm39) missense probably damaging 1.00
R2518:Cit UTSW 5 116,125,105 (GRCm39) missense probably damaging 0.99
R2679:Cit UTSW 5 116,107,174 (GRCm39) missense probably benign 0.00
R2898:Cit UTSW 5 116,012,037 (GRCm39) splice site probably null
R2908:Cit UTSW 5 116,119,735 (GRCm39) missense probably benign 0.00
R3079:Cit UTSW 5 116,063,545 (GRCm39) missense probably damaging 0.97
R3779:Cit UTSW 5 115,997,400 (GRCm39) missense probably benign 0.01
R4081:Cit UTSW 5 116,086,109 (GRCm39) missense probably damaging 1.00
R4494:Cit UTSW 5 116,012,043 (GRCm39) missense probably damaging 1.00
R4610:Cit UTSW 5 116,132,146 (GRCm39) missense probably benign 0.01
R4757:Cit UTSW 5 116,135,608 (GRCm39) missense probably damaging 1.00
R4788:Cit UTSW 5 116,071,565 (GRCm39) missense probably damaging 1.00
R4816:Cit UTSW 5 116,046,750 (GRCm39) missense probably damaging 1.00
R4890:Cit UTSW 5 116,126,182 (GRCm39) intron probably benign
R4899:Cit UTSW 5 116,001,087 (GRCm39) missense possibly damaging 0.60
R5073:Cit UTSW 5 116,084,902 (GRCm39) missense probably benign 0.24
R5151:Cit UTSW 5 116,117,894 (GRCm39) missense probably damaging 1.00
R5154:Cit UTSW 5 116,126,464 (GRCm39) missense probably damaging 1.00
R5222:Cit UTSW 5 116,090,602 (GRCm39) missense probably benign 0.03
R5814:Cit UTSW 5 116,117,478 (GRCm39) missense probably damaging 1.00
R5935:Cit UTSW 5 116,063,598 (GRCm39) intron probably benign
R5946:Cit UTSW 5 116,135,593 (GRCm39) missense probably damaging 1.00
R6051:Cit UTSW 5 115,984,464 (GRCm39) missense probably benign
R6289:Cit UTSW 5 116,144,385 (GRCm39) makesense probably null
R6298:Cit UTSW 5 116,086,124 (GRCm39) missense probably damaging 1.00
R6362:Cit UTSW 5 116,024,735 (GRCm39) missense probably benign 0.01
R6545:Cit UTSW 5 115,984,493 (GRCm39) missense probably null 0.00
R6761:Cit UTSW 5 116,046,734 (GRCm39) missense probably damaging 1.00
R6798:Cit UTSW 5 116,064,585 (GRCm39) missense possibly damaging 0.56
R6814:Cit UTSW 5 116,023,022 (GRCm39) missense probably damaging 1.00
R6825:Cit UTSW 5 116,119,833 (GRCm39) missense probably damaging 0.99
R6845:Cit UTSW 5 116,122,947 (GRCm39) missense probably damaging 1.00
R6983:Cit UTSW 5 116,132,150 (GRCm39) missense probably damaging 1.00
R7164:Cit UTSW 5 116,123,846 (GRCm39) missense possibly damaging 0.94
R7359:Cit UTSW 5 116,064,633 (GRCm39) missense probably damaging 1.00
R7597:Cit UTSW 5 116,024,740 (GRCm39) nonsense probably null
R7729:Cit UTSW 5 116,122,881 (GRCm39) missense possibly damaging 0.87
R7763:Cit UTSW 5 116,125,060 (GRCm39) missense probably benign 0.01
R7786:Cit UTSW 5 116,001,077 (GRCm39) missense probably benign 0.00
R7799:Cit UTSW 5 116,001,027 (GRCm39) missense probably benign 0.00
R8060:Cit UTSW 5 116,046,786 (GRCm39) missense probably benign 0.00
R8068:Cit UTSW 5 116,120,294 (GRCm39) missense probably benign 0.03
R8068:Cit UTSW 5 116,090,525 (GRCm39) missense probably damaging 1.00
R8122:Cit UTSW 5 116,107,069 (GRCm39) missense probably damaging 1.00
R8177:Cit UTSW 5 116,126,218 (GRCm39) missense probably benign 0.18
R8178:Cit UTSW 5 116,107,131 (GRCm39) missense probably damaging 1.00
R8265:Cit UTSW 5 116,126,236 (GRCm39) missense probably damaging 1.00
R8359:Cit UTSW 5 116,122,603 (GRCm39) splice site probably null
R8397:Cit UTSW 5 116,024,856 (GRCm39) missense probably benign
R8489:Cit UTSW 5 116,083,962 (GRCm39) critical splice donor site probably null
R8784:Cit UTSW 5 115,984,442 (GRCm39) nonsense probably null
R8798:Cit UTSW 5 116,107,102 (GRCm39) missense probably damaging 0.99
R8882:Cit UTSW 5 116,001,089 (GRCm39) missense probably benign 0.04
R8984:Cit UTSW 5 116,064,534 (GRCm39) missense possibly damaging 0.86
R9091:Cit UTSW 5 115,984,161 (GRCm39) intron probably benign
R9127:Cit UTSW 5 116,074,896 (GRCm39) nonsense probably null
R9204:Cit UTSW 5 116,126,498 (GRCm39) missense probably damaging 0.99
R9212:Cit UTSW 5 116,013,952 (GRCm39) missense possibly damaging 0.75
R9279:Cit UTSW 5 116,065,970 (GRCm39) missense probably damaging 1.00
R9288:Cit UTSW 5 116,123,512 (GRCm39) missense probably damaging 1.00
R9377:Cit UTSW 5 116,084,914 (GRCm39) missense probably benign 0.04
R9520:Cit UTSW 5 116,079,954 (GRCm39) nonsense probably null
Z1088:Cit UTSW 5 116,123,592 (GRCm39) missense possibly damaging 0.62
Z1176:Cit UTSW 5 116,124,662 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAAAGTGCCCAGGTACCC -3'
(R):5'- CTGGCTTCTAACTTTGAAAATTGGG -3'

Sequencing Primer
(F):5'- AGGGTGGCCACTCTCAG -3'
(R):5'- CTAACTTTGAAAATTGGGAAAGCAG -3'
Posted On 2016-04-15