Incidental Mutation 'R4928:Cit'
ID380981
Institutional Source Beutler Lab
Gene Symbol Cit
Ensembl Gene ENSMUSG00000029516
Gene Namecitron
SynonymsCRIK-SK, C030025P15Rik, Cit-k, citron-N, citron kinase
MMRRC Submission 042529-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R4928 (G1)
Quality Score124
Status Validated
Chromosome5
Chromosomal Location115845278-116008947 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115985797 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1464 (N1464K)
Ref Sequence ENSEMBL: ENSMUSP00000115802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051704] [ENSMUST00000102560] [ENSMUST00000112008] [ENSMUST00000141101]
Predicted Effect probably benign
Transcript: ENSMUST00000051704
AA Change: N1506K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062049
Gene: ENSMUSG00000029516
AA Change: N1506K

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 891 905 N/A INTRINSIC
low complexity region 915 948 N/A INTRINSIC
low complexity region 950 968 N/A INTRINSIC
low complexity region 1068 1081 N/A INTRINSIC
low complexity region 1138 1156 N/A INTRINSIC
low complexity region 1182 1203 N/A INTRINSIC
internal_repeat_1 1243 1282 1.05e-5 PROSPERO
low complexity region 1353 1364 N/A INTRINSIC
C1 1389 1437 1.97e-9 SMART
PH 1470 1591 1.31e-8 SMART
CNH 1618 1915 1.78e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102560
AA Change: N1521K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099620
Gene: ENSMUSG00000029516
AA Change: N1521K

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1244 N/A INTRINSIC
coiled coil region 1297 1338 N/A INTRINSIC
low complexity region 1368 1379 N/A INTRINSIC
C1 1404 1452 1.97e-9 SMART
PH 1485 1606 1.31e-8 SMART
CNH 1633 1930 1.78e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112008
AA Change: N1479K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107639
Gene: ENSMUSG00000029516
AA Change: N1479K

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1202 N/A INTRINSIC
coiled coil region 1255 1296 N/A INTRINSIC
low complexity region 1326 1337 N/A INTRINSIC
C1 1362 1410 1.97e-9 SMART
PH 1443 1564 1.31e-8 SMART
CNH 1591 1888 1.78e-112 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122877
Predicted Effect probably benign
Transcript: ENSMUST00000123736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134609
Predicted Effect probably benign
Transcript: ENSMUST00000141101
AA Change: N1464K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115802
Gene: ENSMUSG00000029516
AA Change: N1464K

DomainStartEndE-ValueType
S_TKc 97 359 1.4e-91 SMART
S_TK_X 360 422 3e-18 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 686 698 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 873 906 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
low complexity region 1026 1039 N/A INTRINSIC
low complexity region 1096 1114 N/A INTRINSIC
low complexity region 1140 1161 N/A INTRINSIC
internal_repeat_1 1201 1240 1.73e-5 PROSPERO
low complexity region 1311 1322 N/A INTRINSIC
C1 1347 1395 9.7e-12 SMART
PH 1428 1549 6e-11 SMART
CNH 1576 1873 8.6e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147479
Meta Mutation Damage Score 0.0863 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 98% (123/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null mutation are 20% smaller than wild-type and exhibit tremors, ataxia, and fatal seizures. Brains of mutant mice show a 50% size reduction with abnormalities in the hippocampus, cerebellum, and olfactory lobes. Mutant males show aberrant cytokinesis of spermatogenic precursors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530021J07Rik G T 7: 83,155,878 noncoding transcript Het
Aasdh T A 5: 76,896,688 K118N possibly damaging Het
Abca14 A T 7: 120,324,580 N1620I possibly damaging Het
Acap1 A T 11: 69,885,815 S149T possibly damaging Het
Adgre1 T A 17: 57,444,064 Y579* probably null Het
AI314180 A G 4: 58,827,073 V1020A probably damaging Het
Aifm3 T C 16: 17,500,432 probably benign Het
Aldh16a1 A G 7: 45,141,961 W107R probably damaging Het
Amer2 A T 14: 60,379,445 H363L possibly damaging Het
Arhgap10 A G 8: 77,426,328 probably null Het
Arhgef6 A T X: 57,234,878 D742E probably damaging Het
Astn2 A T 4: 65,729,407 N731K probably damaging Het
Atp1a2 T C 1: 172,278,387 T904A possibly damaging Het
Atr C T 9: 95,907,299 R1503W probably damaging Het
Cdh3 G T 8: 106,536,610 R97L probably benign Het
Chst2 C T 9: 95,406,006 V96I probably benign Het
Col17a1 A T 19: 47,670,458 probably null Het
Col4a3 G A 1: 82,710,977 probably benign Het
Copz1 T A 15: 103,291,330 S57R probably damaging Het
Cpped1 A T 16: 11,828,279 F227Y probably damaging Het
Cyp2j12 A T 4: 96,102,151 probably null Het
Dctn1 T A 6: 83,189,207 I195N possibly damaging Het
Dhrs7b A G 11: 60,851,925 I148V probably benign Het
Dnah17 T C 11: 118,027,433 D4096G probably damaging Het
Dnajc13 T C 9: 104,233,638 N145D possibly damaging Het
Ercc6l2 T C 13: 63,894,813 probably benign Het
Fads6 T G 11: 115,296,561 I103L probably benign Het
Fam189a1 G T 7: 64,759,368 S426* probably null Het
Fat4 T G 3: 39,010,465 Y4857D probably damaging Het
Fbxl14 T A 6: 119,480,710 L284Q probably damaging Het
Fkbp9 T C 6: 56,849,670 V85A possibly damaging Het
Galnt13 T A 2: 54,516,565 V9E probably damaging Het
Gm14412 A T 2: 177,314,580 S507R probably benign Het
Gm15142 T A X: 154,638,419 noncoding transcript Het
Gm4787 T C 12: 81,378,838 E182G probably benign Het
Gm6811 C A 17: 21,094,631 noncoding transcript Het
Gm9791 A T 3: 34,005,069 noncoding transcript Het
Hoxb7 A T 11: 96,289,510 probably null Het
Ift122 T A 6: 115,915,858 probably benign Het
Krt28 C T 11: 99,374,632 V70I probably benign Het
Lig1 T C 7: 13,298,738 S459P probably damaging Het
Lrfn3 C T 7: 30,360,623 R59H possibly damaging Het
Mavs T C 2: 131,246,743 V489A probably benign Het
Mcm8 C T 2: 132,839,479 P625L probably benign Het
Megf10 G T 18: 57,240,673 R181L probably benign Het
Mgrn1 G A 16: 4,927,862 G440D probably benign Het
Mllt3 T C 4: 87,782,405 probably null Het
Muc5ac T A 7: 141,817,902 Y2613* probably null Het
Myh14 C T 7: 44,635,502 G662S probably benign Het
Myod1 T A 7: 46,377,050 N126K probably damaging Het
Nae1 A T 8: 104,516,142 H439Q possibly damaging Het
Narf T A 11: 121,244,939 V136E possibly damaging Het
Ncapd3 T A 9: 27,071,735 C926* probably null Het
Ndufv2 C A 17: 66,092,658 probably null Het
Neb T C 2: 52,212,975 S449G possibly damaging Het
Nek10 C T 14: 14,930,577 P698L probably damaging Het
Nox3 T A 17: 3,635,275 E566V probably null Het
Oas1a C T 5: 120,905,724 R115H probably benign Het
Olfr1076 T A 2: 86,509,125 L222H probably damaging Het
Olfr1130 C A 2: 87,608,143 L252I probably benign Het
Olfr1152 A G 2: 87,868,230 M80V probably benign Het
Olfr65 A G 7: 103,906,672 T78A probably damaging Het
Pbld2 A G 10: 63,047,999 H142R probably damaging Het
Pcdha4 C T 18: 36,954,816 T684M probably benign Het
Phc3 G T 3: 30,950,919 T175N probably damaging Het
Pigs G T 11: 78,329,002 V68L probably damaging Het
Pik3c2g T A 6: 139,967,802 D857E possibly damaging Het
Pitpnm3 G A 11: 72,063,172 P550S probably damaging Het
Pla2g15 G A 8: 106,163,218 W374* probably null Het
Ptpn14 G A 1: 189,822,642 C133Y probably damaging Het
Ptpn20 A G 14: 33,614,489 N95S probably benign Het
Ptrh2 G T 11: 86,690,036 V160F probably damaging Het
Rapgef3 T C 15: 97,757,375 D486G probably damaging Het
Rev3l T G 10: 39,823,985 S1493A probably benign Het
Rgs9 T A 11: 109,225,744 D411V probably benign Het
Rgsl1 A T 1: 153,793,768 Y291N probably damaging Het
Rprd2 A G 3: 95,764,537 Y1185H probably damaging Het
Rpusd3 A G 6: 113,416,206 probably benign Het
Scnn1a T C 6: 125,322,173 I72T probably damaging Het
Sdk1 A T 5: 141,857,003 probably benign Het
Sfmbt2 T C 2: 10,445,745 L277P probably benign Het
Sgf29 A G 7: 126,664,982 E73G probably damaging Het
Slc12a6 T A 2: 112,352,961 F764L probably damaging Het
Slc4a2 T C 5: 24,435,342 probably null Het
Slc9a3 T G 13: 74,157,719 V285G probably damaging Het
Slc9c1 A G 16: 45,575,409 T608A probably benign Het
Slfnl1 C T 4: 120,535,685 R325C probably damaging Het
Smarcad1 T A 6: 65,074,914 F344I probably benign Het
Snrnp70 A T 7: 45,377,281 probably null Het
Sod2 C T 17: 13,008,186 T9M probably benign Het
Spag5 T A 11: 78,314,373 S633T probably damaging Het
Spta1 A T 1: 174,191,056 I531L probably benign Het
Stra8 A G 6: 34,933,156 E60G probably benign Het
Sult2a3 T A 7: 14,111,557 I126F probably benign Het
Syt1 T C 10: 108,504,512 H315R possibly damaging Het
Tanc2 T C 11: 105,867,762 L783P probably damaging Het
Thbs2 C T 17: 14,678,900 C646Y probably damaging Het
Ticam2 T A 18: 46,560,922 K33* probably null Het
Trim17 T C 11: 58,954,301 probably benign Het
Tsr1 G A 11: 74,907,879 M691I probably benign Het
Ttn T A 2: 76,762,419 I20790F probably damaging Het
Tubb2b A T 13: 34,128,185 Y208* probably null Het
Ubr1 T A 2: 120,914,938 I890F probably damaging Het
Usp54 T C 14: 20,562,192 E852G probably damaging Het
Vmn2r78 T C 7: 86,954,627 V671A probably damaging Het
Wipi1 T C 11: 109,579,649 K315E probably benign Het
Xrn2 T C 2: 147,051,718 V735A possibly damaging Het
Zdbf2 T A 1: 63,308,814 D2117E possibly damaging Het
Zfp287 A T 11: 62,714,136 C648* probably null Het
Zfp369 A G 13: 65,296,800 T586A possibly damaging Het
Other mutations in Cit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Cit APN 5 115846465 missense probably damaging 0.99
IGL00482:Cit APN 5 115938755 missense probably damaging 0.97
IGL01317:Cit APN 5 115908716 missense probably benign 0.03
IGL01335:Cit APN 5 115908830 splice site probably benign
IGL01415:Cit APN 5 115941903 missense possibly damaging 0.78
IGL01447:Cit APN 5 115873843 splice site probably benign
IGL01537:Cit APN 5 115933854 missense probably benign 0.00
IGL01621:Cit APN 5 115992603 splice site probably benign
IGL02010:Cit APN 5 115875947 missense probably damaging 1.00
IGL02538:Cit APN 5 115986989 nonsense probably null
IGL02607:Cit APN 5 115859209 missense probably benign
IGL02720:Cit APN 5 115995452 missense probably benign 0.26
IGL02725:Cit APN 5 115985473 missense probably benign 0.02
IGL02967:Cit APN 5 115945837 missense probably benign 0.11
IGL02973:Cit APN 5 116005999 missense possibly damaging 0.73
IGL03383:Cit APN 5 115873845 splice site probably benign
PIT4514001:Cit UTSW 5 115997854 critical splice donor site probably null
R0206:Cit UTSW 5 115994030 missense possibly damaging 0.72
R0206:Cit UTSW 5 115994030 missense possibly damaging 0.72
R0226:Cit UTSW 5 115984840 missense probably damaging 0.99
R0320:Cit UTSW 5 115979445 missense possibly damaging 0.87
R0401:Cit UTSW 5 115985479 missense probably benign 0.06
R0480:Cit UTSW 5 115933393 splice site probably benign
R0609:Cit UTSW 5 115873943 missense probably damaging 0.98
R0737:Cit UTSW 5 115946919 missense probably damaging 1.00
R1238:Cit UTSW 5 115851221 missense probably benign 0.30
R1503:Cit UTSW 5 115873900 missense possibly damaging 0.94
R1551:Cit UTSW 5 115945842 missense probably benign 0.00
R1602:Cit UTSW 5 115997730 missense probably damaging 1.00
R1720:Cit UTSW 5 115967897 missense probably damaging 0.98
R1854:Cit UTSW 5 115873901 missense probably damaging 1.00
R1886:Cit UTSW 5 115933486 missense probably damaging 1.00
R2024:Cit UTSW 5 115947924 missense probably damaging 0.97
R2024:Cit UTSW 5 116005840 missense probably damaging 0.97
R2048:Cit UTSW 5 115886813 splice site probably null
R2128:Cit UTSW 5 115985507 missense possibly damaging 0.63
R2192:Cit UTSW 5 115968009 missense probably benign 0.00
R2244:Cit UTSW 5 115926505 missense probably damaging 1.00
R2518:Cit UTSW 5 115987046 missense probably damaging 0.99
R2679:Cit UTSW 5 115969115 missense probably benign 0.00
R2898:Cit UTSW 5 115873978 splice site probably null
R2908:Cit UTSW 5 115981676 missense probably benign 0.00
R3079:Cit UTSW 5 115925486 missense probably damaging 0.97
R3779:Cit UTSW 5 115859341 missense probably benign 0.01
R4081:Cit UTSW 5 115948050 missense probably damaging 1.00
R4494:Cit UTSW 5 115873984 missense probably damaging 1.00
R4610:Cit UTSW 5 115994087 missense probably benign 0.01
R4757:Cit UTSW 5 115997549 missense probably damaging 1.00
R4788:Cit UTSW 5 115933506 missense probably damaging 1.00
R4816:Cit UTSW 5 115908691 missense probably damaging 1.00
R4890:Cit UTSW 5 115988123 intron probably benign
R4899:Cit UTSW 5 115863028 missense possibly damaging 0.60
R5073:Cit UTSW 5 115946843 missense probably benign 0.24
R5151:Cit UTSW 5 115979835 missense probably damaging 1.00
R5154:Cit UTSW 5 115988405 missense probably damaging 1.00
R5222:Cit UTSW 5 115952543 missense probably benign 0.03
R5814:Cit UTSW 5 115979419 missense probably damaging 1.00
R5935:Cit UTSW 5 115925539 intron probably benign
R5946:Cit UTSW 5 115997534 missense probably damaging 1.00
R6051:Cit UTSW 5 115846405 missense probably benign
R6289:Cit UTSW 5 116006326 makesense probably null
R6298:Cit UTSW 5 115948065 missense probably damaging 1.00
R6362:Cit UTSW 5 115886676 missense probably benign 0.01
R6545:Cit UTSW 5 115846434 missense probably null 0.00
R6761:Cit UTSW 5 115908675 missense probably damaging 1.00
R6798:Cit UTSW 5 115926526 missense possibly damaging 0.56
R6814:Cit UTSW 5 115884963 missense probably damaging 1.00
R6825:Cit UTSW 5 115981774 missense probably damaging 0.99
R6845:Cit UTSW 5 115984888 missense probably damaging 1.00
R6983:Cit UTSW 5 115994091 missense probably damaging 1.00
R7164:Cit UTSW 5 115985787 missense possibly damaging 0.94
R7359:Cit UTSW 5 115926574 missense probably damaging 1.00
R7597:Cit UTSW 5 115886681 nonsense probably null
R7729:Cit UTSW 5 115984822 missense possibly damaging 0.87
R7763:Cit UTSW 5 115987001 missense probably benign 0.01
R7786:Cit UTSW 5 115863018 missense probably benign 0.00
R7799:Cit UTSW 5 115862968 missense probably benign 0.00
R8060:Cit UTSW 5 115908727 missense probably benign 0.00
R8068:Cit UTSW 5 115952466 missense probably damaging 1.00
R8068:Cit UTSW 5 115982235 missense probably benign 0.03
R8122:Cit UTSW 5 115969010 missense probably damaging 1.00
R8177:Cit UTSW 5 115988159 missense probably benign 0.18
R8178:Cit UTSW 5 115969072 missense probably damaging 1.00
R8265:Cit UTSW 5 115988177 missense probably damaging 1.00
R8359:Cit UTSW 5 115984544 splice site probably null
R8397:Cit UTSW 5 115886797 missense probably benign
R8489:Cit UTSW 5 115945903 critical splice donor site probably null
R8784:Cit UTSW 5 115846383 nonsense probably null
R8798:Cit UTSW 5 115969043 missense probably damaging 0.99
R8882:Cit UTSW 5 115863030 missense probably benign 0.04
Z1088:Cit UTSW 5 115985533 missense possibly damaging 0.62
Z1176:Cit UTSW 5 115986603 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAAAGTGCCCAGGTACCC -3'
(R):5'- CTGGCTTCTAACTTTGAAAATTGGG -3'

Sequencing Primer
(F):5'- AGGGTGGCCACTCTCAG -3'
(R):5'- CTAACTTTGAAAATTGGGAAAGCAG -3'
Posted On2016-04-15