Mutagenetix > Incidental Mutation

Incidental Mutation 'R4928:Stra8'

380984

Institutional Source

Beutler Lab

Gene Symbol

Stra8

Ensembl Gene

ENSMUSG00000029848

Gene Name

stimulated by retinoic acid gene 8

Synonyms

MMRRC Submission

042529-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.205) question?

Stock #

R4928 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34920163-34939344 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34933156 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 60 (E60G)

Ref Sequence

ENSEMBL: ENSMUSP00000110649 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031876] [ENSMUST00000114997] [ENSMUST00000114999] [ENSMUST00000185102]

AlphaFold

P70278

Predicted Effect

probably benign
Transcript: ENSMUST00000031876
AA Change: E171G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000031876
Gene: ENSMUSG00000029848
AA Change: E171G

Domain	Start	End	E-Value	Type
Blast:HLH	34	83	5e-20	BLAST
coiled coil region	159	201	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114997
AA Change: E60G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000110649
Gene: ENSMUSG00000029848
AA Change: E60G

Domain	Start	End	E-Value	Type
coiled coil region	48	90	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114999
AA Change: E171G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000110651
Gene: ENSMUSG00000029848
AA Change: E171G

Domain	Start	End	E-Value	Type
Blast:HLH	34	83	5e-20	BLAST
coiled coil region	159	201	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000185102

SMART Domains

Protein: ENSMUSP00000139136
Gene: ENSMUSG00000029848

Domain	Start	End	E-Value	Type
low complexity region	122	146	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

98% (123/126)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retinoic acid-responsive protein. A homologous protein in mouse has been shown to be involved in the regulation of meiotic initiation in both spermatogenesis and oogenesis, though feature differences between the mouse and human proteins suggest that these homologs are not entirely functionally equivalent. It is thought that this gene may play a role in spermatogenesis in humans. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mice display impaired meiosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 110 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530021J07Rik	G	T	7: 83,155,878		noncoding transcript	Het
Aasdh	T	A	5: 76,896,688	K118N	possibly damaging	Het
Abca14	A	T	7: 120,324,580	N1620I	possibly damaging	Het
Acap1	A	T	11: 69,885,815	S149T	possibly damaging	Het
Adgre1	T	A	17: 57,444,064	Y579*	probably null	Het
AI314180	A	G	4: 58,827,073	V1020A	probably damaging	Het
Aifm3	T	C	16: 17,500,432		probably benign	Het
Aldh16a1	A	G	7: 45,141,961	W107R	probably damaging	Het
Amer2	A	T	14: 60,379,445	H363L	possibly damaging	Het
Arhgap10	A	G	8: 77,426,328		probably null	Het
Arhgef6	A	T	X: 57,234,878	D742E	probably damaging	Het
Astn2	A	T	4: 65,729,407	N731K	probably damaging	Het
Atp1a2	T	C	1: 172,278,387	T904A	possibly damaging	Het
Atr	C	T	9: 95,907,299	R1503W	probably damaging	Het
Cdh3	G	T	8: 106,536,610	R97L	probably benign	Het
Chst2	C	T	9: 95,406,006	V96I	probably benign	Het
Cit	T	A	5: 115,985,797	N1464K	probably benign	Het
Col17a1	A	T	19: 47,670,458		probably null	Het
Col4a3	G	A	1: 82,710,977		probably benign	Het
Copz1	T	A	15: 103,291,330	S57R	probably damaging	Het
Cpped1	A	T	16: 11,828,279	F227Y	probably damaging	Het
Cyp2j12	A	T	4: 96,102,151		probably null	Het
Dctn1	T	A	6: 83,189,207	I195N	possibly damaging	Het
Dhrs7b	A	G	11: 60,851,925	I148V	probably benign	Het
Dnah17	T	C	11: 118,027,433	D4096G	probably damaging	Het
Dnajc13	T	C	9: 104,233,638	N145D	possibly damaging	Het
Ercc6l2	T	C	13: 63,894,813		probably benign	Het
Fads6	T	G	11: 115,296,561	I103L	probably benign	Het
Fam189a1	G	T	7: 64,759,368	S426*	probably null	Het
Fat4	T	G	3: 39,010,465	Y4857D	probably damaging	Het
Fbxl14	T	A	6: 119,480,710	L284Q	probably damaging	Het
Fkbp9	T	C	6: 56,849,670	V85A	possibly damaging	Het
Galnt13	T	A	2: 54,516,565	V9E	probably damaging	Het
Gm14412	A	T	2: 177,314,580	S507R	probably benign	Het
Gm15142	T	A	X: 154,638,419		noncoding transcript	Het
Gm4787	T	C	12: 81,378,838	E182G	probably benign	Het
Gm6811	C	A	17: 21,094,631		noncoding transcript	Het
Gm9791	A	T	3: 34,005,069		noncoding transcript	Het
Hoxb7	A	T	11: 96,289,510		probably null	Het
Ift122	T	A	6: 115,915,858		probably benign	Het
Krt28	C	T	11: 99,374,632	V70I	probably benign	Het
Lig1	T	C	7: 13,298,738	S459P	probably damaging	Het
Lrfn3	C	T	7: 30,360,623	R59H	possibly damaging	Het
Mavs	T	C	2: 131,246,743	V489A	probably benign	Het
Mcm8	C	T	2: 132,839,479	P625L	probably benign	Het
Megf10	G	T	18: 57,240,673	R181L	probably benign	Het
Mgrn1	G	A	16: 4,927,862	G440D	probably benign	Het
Mllt3	T	C	4: 87,782,405		probably null	Het
Muc5ac	T	A	7: 141,817,902	Y2613*	probably null	Het
Myh14	C	T	7: 44,635,502	G662S	probably benign	Het
Myod1	T	A	7: 46,377,050	N126K	probably damaging	Het
Nae1	A	T	8: 104,516,142	H439Q	possibly damaging	Het
Narf	T	A	11: 121,244,939	V136E	possibly damaging	Het
Ncapd3	T	A	9: 27,071,735	C926*	probably null	Het
Ndufv2	C	A	17: 66,092,658		probably null	Het
Neb	T	C	2: 52,212,975	S449G	possibly damaging	Het
Nek10	C	T	14: 14,930,577	P698L	probably damaging	Het
Nox3	T	A	17: 3,635,275	E566V	probably null	Het
Oas1a	C	T	5: 120,905,724	R115H	probably benign	Het
Olfr1076	T	A	2: 86,509,125	L222H	probably damaging	Het
Olfr1130	C	A	2: 87,608,143	L252I	probably benign	Het
Olfr1152	A	G	2: 87,868,230	M80V	probably benign	Het
Olfr65	A	G	7: 103,906,672	T78A	probably damaging	Het
Pbld2	A	G	10: 63,047,999	H142R	probably damaging	Het
Pcdha4	C	T	18: 36,954,816	T684M	probably benign	Het
Phc3	G	T	3: 30,950,919	T175N	probably damaging	Het
Pigs	G	T	11: 78,329,002	V68L	probably damaging	Het
Pik3c2g	T	A	6: 139,967,802	D857E	possibly damaging	Het
Pitpnm3	G	A	11: 72,063,172	P550S	probably damaging	Het
Pla2g15	G	A	8: 106,163,218	W374*	probably null	Het
Ptpn14	G	A	1: 189,822,642	C133Y	probably damaging	Het
Ptpn20	A	G	14: 33,614,489	N95S	probably benign	Het
Ptrh2	G	T	11: 86,690,036	V160F	probably damaging	Het
Rapgef3	T	C	15: 97,757,375	D486G	probably damaging	Het
Rev3l	T	G	10: 39,823,985	S1493A	probably benign	Het
Rgs9	T	A	11: 109,225,744	D411V	probably benign	Het
Rgsl1	A	T	1: 153,793,768	Y291N	probably damaging	Het
Rprd2	A	G	3: 95,764,537	Y1185H	probably damaging	Het
Rpusd3	A	G	6: 113,416,206		probably benign	Het
Scnn1a	T	C	6: 125,322,173	I72T	probably damaging	Het
Sdk1	A	T	5: 141,857,003		probably benign	Het
Sfmbt2	T	C	2: 10,445,745	L277P	probably benign	Het
Sgf29	A	G	7: 126,664,982	E73G	probably damaging	Het
Slc12a6	T	A	2: 112,352,961	F764L	probably damaging	Het
Slc4a2	T	C	5: 24,435,342		probably null	Het
Slc9a3	T	G	13: 74,157,719	V285G	probably damaging	Het
Slc9c1	A	G	16: 45,575,409	T608A	probably benign	Het
Slfnl1	C	T	4: 120,535,685	R325C	probably damaging	Het
Smarcad1	T	A	6: 65,074,914	F344I	probably benign	Het
Snrnp70	A	T	7: 45,377,281		probably null	Het
Sod2	C	T	17: 13,008,186	T9M	probably benign	Het
Spag5	T	A	11: 78,314,373	S633T	probably damaging	Het
Spta1	A	T	1: 174,191,056	I531L	probably benign	Het
Sult2a3	T	A	7: 14,111,557	I126F	probably benign	Het
Syt1	T	C	10: 108,504,512	H315R	possibly damaging	Het
Tanc2	T	C	11: 105,867,762	L783P	probably damaging	Het
Thbs2	C	T	17: 14,678,900	C646Y	probably damaging	Het
Ticam2	T	A	18: 46,560,922	K33*	probably null	Het
Trim17	T	C	11: 58,954,301		probably benign	Het
Tsr1	G	A	11: 74,907,879	M691I	probably benign	Het
Ttn	T	A	2: 76,762,419	I20790F	probably damaging	Het
Tubb2b	A	T	13: 34,128,185	Y208*	probably null	Het
Ubr1	T	A	2: 120,914,938	I890F	probably damaging	Het
Usp54	T	C	14: 20,562,192	E852G	probably damaging	Het
Vmn2r78	T	C	7: 86,954,627	V671A	probably damaging	Het
Wipi1	T	C	11: 109,579,649	K315E	probably benign	Het
Xrn2	T	C	2: 147,051,718	V735A	possibly damaging	Het
Zdbf2	T	A	1: 63,308,814	D2117E	possibly damaging	Het
Zfp287	A	T	11: 62,714,136	C648*	probably null	Het
Zfp369	A	G	13: 65,296,800	T586A	possibly damaging	Het

Other mutations in Stra8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00862:Stra8	APN	6	34938063	missense	probably benign	0.09
IGL01336:Stra8	APN	6	34933188	missense	possibly damaging	0.75
IGL02110:Stra8	APN	6	34930354	splice site	probably benign
IGL02572:Stra8	APN	6	34939159	missense	probably damaging	1.00
rounded	UTSW	6	34933040	nonsense	probably null
R1740:Stra8	UTSW	6	34927719	splice site	probably benign
R5412:Stra8	UTSW	6	34930950	start codon destroyed	probably null	0.46
R5709:Stra8	UTSW	6	34927762	missense	possibly damaging	0.73
R6558:Stra8	UTSW	6	34933040	nonsense	probably null
R7081:Stra8	UTSW	6	34934367	critical splice donor site	probably null
R7673:Stra8	UTSW	6	34927918	critical splice donor site	probably null
R7845:Stra8	UTSW	6	34930964	missense	probably benign	0.23
R7946:Stra8	UTSW	6	34930881	critical splice acceptor site	probably null
R8773:Stra8	UTSW	6	34935646	missense	probably damaging	0.98
R8933:Stra8	UTSW	6	34927689	intron	probably benign
R9149:Stra8	UTSW	6	34934081	missense	probably damaging	1.00
R9484:Stra8	UTSW	6	34934186	missense	probably damaging	1.00
R9512:Stra8	UTSW	6	34933053	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGGTGAGATTTGCCAAGCAC -3'
(R):5'- GTCTGTCCCTTTGCCAATAGAATC -3'

Sequencing Primer
(F):5'- GAGATTTGCCAAGCACCCTCTTG -3'
(R):5'- TTGCCAATAGAATCCCCCTGCG -3'

Posted On

2016-04-15