Incidental Mutation 'R0400:Zbtb43'
ID38099
Institutional Source Beutler Lab
Gene Symbol Zbtb43
Ensembl Gene ENSMUSG00000026788
Gene Namezinc finger and BTB domain containing 43
SynonymsZfp297b, 1700010E06Rik
MMRRC Submission 038605-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0400 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location33450287-33468559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33453897 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 439 (C439R)
Ref Sequence ENSEMBL: ENSMUSP00000108781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028125] [ENSMUST00000095035] [ENSMUST00000113156] [ENSMUST00000126442] [ENSMUST00000155198]
Predicted Effect probably damaging
Transcript: ENSMUST00000028125
AA Change: C402R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028125
Gene: ENSMUSG00000026788
AA Change: C402R

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
BTB 33 127 4.98e-25 SMART
ZnF_C2H2 373 394 1.2e1 SMART
ZnF_C2H2 400 422 4.47e-3 SMART
ZnF_C2H2 428 448 2.01e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095035
AA Change: C439R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092645
Gene: ENSMUSG00000026788
AA Change: C439R

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
BTB 70 164 4.98e-25 SMART
ZnF_C2H2 410 431 1.2e1 SMART
ZnF_C2H2 437 459 4.47e-3 SMART
ZnF_C2H2 465 485 2.01e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113156
AA Change: C439R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108781
Gene: ENSMUSG00000026788
AA Change: C439R

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
BTB 33 127 4.98e-25 SMART
ZnF_C2H2 373 394 1.2e1 SMART
ZnF_C2H2 400 422 4.47e-3 SMART
ZnF_C2H2 428 448 2.01e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126442
SMART Domains Protein: ENSMUSP00000122729
Gene: ENSMUSG00000026788

DomainStartEndE-ValueType
Pfam:BTB 23 69 6.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132913
Predicted Effect probably benign
Transcript: ENSMUST00000155198
SMART Domains Protein: ENSMUSP00000120989
Gene: ENSMUSG00000026788

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
BTB 33 127 4.98e-25 SMART
Meta Mutation Damage Score 0.9733 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik T A 11: 30,426,360 H169L probably benign Het
9130230L23Rik T C 5: 65,990,356 D28G unknown Het
Abca12 T A 1: 71,259,776 probably benign Het
Acsl5 T C 19: 55,293,711 V573A probably damaging Het
Agap1 A G 1: 89,843,250 probably benign Het
Arid2 A G 15: 96,356,925 probably benign Het
B430305J03Rik T A 3: 61,364,135 probably benign Het
Brsk2 T C 7: 141,998,553 L584P probably damaging Het
C2cd4c A G 10: 79,613,209 Y35H probably damaging Het
Cacul1 A G 19: 60,563,153 probably benign Het
Cers3 T C 7: 66,764,330 V88A probably benign Het
Cnnm1 A T 19: 43,468,364 H614L probably damaging Het
Col1a1 T A 11: 94,941,369 probably benign Het
Cyp1b1 T A 17: 79,713,587 D242V probably damaging Het
Cyp4a31 T C 4: 115,563,718 M1T probably null Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dclk2 A T 3: 86,813,747 probably null Het
Ddx58 A G 4: 40,235,257 Y78H probably benign Het
Dnah17 A G 11: 118,082,078 S2010P probably damaging Het
Dram2 T C 3: 106,573,618 L246P probably damaging Het
Dus2 A T 8: 106,048,677 T279S probably benign Het
Epn2 T C 11: 61,532,696 probably null Het
Esco2 C A 14: 65,831,706 V52F possibly damaging Het
Fbp1 T A 13: 62,865,068 T104S probably benign Het
Foxj2 A T 6: 122,833,808 Q249L possibly damaging Het
Galnt7 T C 8: 57,583,989 Y122C probably damaging Het
Gimd1 T C 3: 132,634,827 Y35H probably benign Het
Gipc2 A G 3: 152,165,668 F74L probably damaging Het
Glt1d1 T A 5: 127,657,075 probably benign Het
Hmcn2 A G 2: 31,400,129 T2325A probably damaging Het
Iffo1 A G 6: 125,153,471 K471R probably damaging Het
Ireb2 G A 9: 54,896,498 R491H probably benign Het
Isg20 A G 7: 78,916,725 N141D possibly damaging Het
Kmt5c G A 7: 4,746,244 R100H probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrn4 A C 2: 132,878,020 F287V probably benign Het
Mmrn1 A C 6: 60,977,115 K793N probably benign Het
Muc16 A G 9: 18,510,534 V8227A possibly damaging Het
Myh2 C T 11: 67,192,598 probably benign Het
Nalcn T A 14: 123,290,960 probably benign Het
Nfia T C 4: 98,063,136 V400A probably damaging Het
Nxph4 T A 10: 127,526,258 T255S possibly damaging Het
Olfm5 G A 7: 104,154,179 T359I probably damaging Het
Olfr141 A G 2: 86,806,651 M116T probably damaging Het
Olfr393 T C 11: 73,848,041 Y28C probably benign Het
Olfr907 A G 9: 38,498,911 M81V possibly damaging Het
Olfr935 G T 9: 38,995,198 P79Q probably damaging Het
Pak7 T C 2: 136,097,579 I545M possibly damaging Het
Pcdhb15 T C 18: 37,475,895 F727L probably benign Het
Pds5b T A 5: 150,723,353 N202K possibly damaging Het
Phlpp1 T A 1: 106,392,934 I1553N probably benign Het
Pink1 T C 4: 138,317,918 T282A probably damaging Het
Prdm2 A G 4: 143,111,670 F1706S probably benign Het
Pycr1 G A 11: 120,641,526 probably benign Het
Skint9 A G 4: 112,414,001 S71P probably damaging Het
Smad1 A G 8: 79,371,770 probably benign Het
Snapc5 A T 9: 64,180,507 E33D probably damaging Het
Snrnp40 T C 4: 130,362,650 L56P probably damaging Het
Stab2 A C 10: 86,872,610 I1697S probably damaging Het
Tfap2a G T 13: 40,717,412 probably benign Het
Tmem57 T C 4: 134,828,116 K349E probably benign Het
Tph2 A G 10: 115,080,120 probably benign Het
Triml1 A G 8: 43,141,040 V118A probably benign Het
Ttbk2 T A 2: 120,750,242 T538S probably benign Het
Ttn A G 2: 76,715,272 V32569A possibly damaging Het
U2af1 T A 17: 31,648,192 Y158F probably benign Het
Usp7 A T 16: 8,716,632 probably benign Het
Vdr A G 15: 97,869,351 S179P probably benign Het
Vps13d A C 4: 145,065,827 S663A probably benign Het
Wdr62 T A 7: 30,241,462 T844S possibly damaging Het
Wipi1 C T 11: 109,577,130 R407Q probably damaging Het
Zfp507 T A 7: 35,791,746 H704L probably damaging Het
Zzef1 G A 11: 72,895,242 R2080K probably damaging Het
Other mutations in Zbtb43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Zbtb43 APN 2 33453759 missense probably benign 0.23
IGL01302:Zbtb43 APN 2 33454091 missense probably benign 0.19
IGL02163:Zbtb43 APN 2 33453783 missense possibly damaging 0.75
IGL03212:Zbtb43 APN 2 33454274 missense probably benign 0.07
R0084:Zbtb43 UTSW 2 33453984 missense probably damaging 1.00
R2136:Zbtb43 UTSW 2 33454520 missense probably damaging 1.00
R4528:Zbtb43 UTSW 2 33462325 intron probably benign
R4609:Zbtb43 UTSW 2 33454043 missense probably benign 0.21
R4856:Zbtb43 UTSW 2 33453932 missense probably damaging 1.00
R5131:Zbtb43 UTSW 2 33454766 missense probably damaging 0.99
R5984:Zbtb43 UTSW 2 33454260 missense probably benign 0.21
R6606:Zbtb43 UTSW 2 33455054 missense probably damaging 1.00
R7189:Zbtb43 UTSW 2 33462295 missense probably benign
R7837:Zbtb43 UTSW 2 33453969 missense probably damaging 1.00
R7920:Zbtb43 UTSW 2 33453969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCCTTTGCAGCTTCATAGGAC -3'
(R):5'- CAGCAGCTATGATGAACAGGTGGAC -3'

Sequencing Primer
(F):5'- CTTGGTACAAGAAGTCACATGC -3'
(R):5'- AACAGGTGGACTTCTATGGCTC -3'
Posted On2013-05-23