Mutagenetix > Incidental Mutation

Incidental Mutation 'R4928:Pik3c2g'

380993

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2g

Ensembl Gene

ENSMUSG00000030228

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma

Synonyms

MMRRC Submission

042529-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R4928 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

139587221-139969284 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 139967802 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 857 (D857E)

Ref Sequence

ENSEMBL: ENSMUSP00000151281 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087657] [ENSMUST00000111868] [ENSMUST00000218528]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000087657
AA Change: D607E

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000084939
Gene: ENSMUSG00000030228
AA Change: D607E

Domain	Start	End	E-Value	Type
PI3Kc	125	387	2.11e-109	SMART
PX	411	515	1.24e-21	SMART
C2	550	647	1.34e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111868
AA Change: D975E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: D975E

Domain	Start	End	E-Value	Type
SCOP:d1e8xa2	1	83	4e-16	SMART
PI3Ka	103	288	7.6e-29	SMART
PI3Kc	375	637	2.11e-109	SMART
PX	661	765	1.24e-21	SMART
C2	800	897	1.34e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189374

SMART Domains

Protein: ENSMUSP00000139763
Gene: ENSMUSG00000030228

Domain	Start	End	E-Value	Type
PI3Kc	125	387	2.11e-109	SMART
PX	411	515	1.24e-21	SMART
C2	550	647	1.34e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206646
AA Change: D607E

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218528
AA Change: D857E

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

Meta Mutation Damage Score

0.0830

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

98% (123/126)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 110 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530021J07Rik	G	T	7: 83,155,878		noncoding transcript	Het
Aasdh	T	A	5: 76,896,688	K118N	possibly damaging	Het
Abca14	A	T	7: 120,324,580	N1620I	possibly damaging	Het
Acap1	A	T	11: 69,885,815	S149T	possibly damaging	Het
Adgre1	T	A	17: 57,444,064	Y579*	probably null	Het
AI314180	A	G	4: 58,827,073	V1020A	probably damaging	Het
Aifm3	T	C	16: 17,500,432		probably benign	Het
Aldh16a1	A	G	7: 45,141,961	W107R	probably damaging	Het
Amer2	A	T	14: 60,379,445	H363L	possibly damaging	Het
Arhgap10	A	G	8: 77,426,328		probably null	Het
Arhgef6	A	T	X: 57,234,878	D742E	probably damaging	Het
Astn2	A	T	4: 65,729,407	N731K	probably damaging	Het
Atp1a2	T	C	1: 172,278,387	T904A	possibly damaging	Het
Atr	C	T	9: 95,907,299	R1503W	probably damaging	Het
Cdh3	G	T	8: 106,536,610	R97L	probably benign	Het
Chst2	C	T	9: 95,406,006	V96I	probably benign	Het
Cit	T	A	5: 115,985,797	N1464K	probably benign	Het
Col17a1	A	T	19: 47,670,458		probably null	Het
Col4a3	G	A	1: 82,710,977		probably benign	Het
Copz1	T	A	15: 103,291,330	S57R	probably damaging	Het
Cpped1	A	T	16: 11,828,279	F227Y	probably damaging	Het
Cyp2j12	A	T	4: 96,102,151		probably null	Het
Dctn1	T	A	6: 83,189,207	I195N	possibly damaging	Het
Dhrs7b	A	G	11: 60,851,925	I148V	probably benign	Het
Dnah17	T	C	11: 118,027,433	D4096G	probably damaging	Het
Dnajc13	T	C	9: 104,233,638	N145D	possibly damaging	Het
Ercc6l2	T	C	13: 63,894,813		probably benign	Het
Fads6	T	G	11: 115,296,561	I103L	probably benign	Het
Fam189a1	G	T	7: 64,759,368	S426*	probably null	Het
Fat4	T	G	3: 39,010,465	Y4857D	probably damaging	Het
Fbxl14	T	A	6: 119,480,710	L284Q	probably damaging	Het
Fkbp9	T	C	6: 56,849,670	V85A	possibly damaging	Het
Galnt13	T	A	2: 54,516,565	V9E	probably damaging	Het
Gm14412	A	T	2: 177,314,580	S507R	probably benign	Het
Gm15142	T	A	X: 154,638,419		noncoding transcript	Het
Gm4787	T	C	12: 81,378,838	E182G	probably benign	Het
Gm6811	C	A	17: 21,094,631		noncoding transcript	Het
Gm9791	A	T	3: 34,005,069		noncoding transcript	Het
Hoxb7	A	T	11: 96,289,510		probably null	Het
Ift122	T	A	6: 115,915,858		probably benign	Het
Krt28	C	T	11: 99,374,632	V70I	probably benign	Het
Lig1	T	C	7: 13,298,738	S459P	probably damaging	Het
Lrfn3	C	T	7: 30,360,623	R59H	possibly damaging	Het
Mavs	T	C	2: 131,246,743	V489A	probably benign	Het
Mcm8	C	T	2: 132,839,479	P625L	probably benign	Het
Megf10	G	T	18: 57,240,673	R181L	probably benign	Het
Mgrn1	G	A	16: 4,927,862	G440D	probably benign	Het
Mllt3	T	C	4: 87,782,405		probably null	Het
Muc5ac	T	A	7: 141,817,902	Y2613*	probably null	Het
Myh14	C	T	7: 44,635,502	G662S	probably benign	Het
Myod1	T	A	7: 46,377,050	N126K	probably damaging	Het
Nae1	A	T	8: 104,516,142	H439Q	possibly damaging	Het
Narf	T	A	11: 121,244,939	V136E	possibly damaging	Het
Ncapd3	T	A	9: 27,071,735	C926*	probably null	Het
Ndufv2	C	A	17: 66,092,658		probably null	Het
Neb	T	C	2: 52,212,975	S449G	possibly damaging	Het
Nek10	C	T	14: 14,930,577	P698L	probably damaging	Het
Nox3	T	A	17: 3,635,275	E566V	probably null	Het
Oas1a	C	T	5: 120,905,724	R115H	probably benign	Het
Olfr1076	T	A	2: 86,509,125	L222H	probably damaging	Het
Olfr1130	C	A	2: 87,608,143	L252I	probably benign	Het
Olfr1152	A	G	2: 87,868,230	M80V	probably benign	Het
Olfr65	A	G	7: 103,906,672	T78A	probably damaging	Het
Pbld2	A	G	10: 63,047,999	H142R	probably damaging	Het
Pcdha4	C	T	18: 36,954,816	T684M	probably benign	Het
Phc3	G	T	3: 30,950,919	T175N	probably damaging	Het
Pigs	G	T	11: 78,329,002	V68L	probably damaging	Het
Pitpnm3	G	A	11: 72,063,172	P550S	probably damaging	Het
Pla2g15	G	A	8: 106,163,218	W374*	probably null	Het
Ptpn14	G	A	1: 189,822,642	C133Y	probably damaging	Het
Ptpn20	A	G	14: 33,614,489	N95S	probably benign	Het
Ptrh2	G	T	11: 86,690,036	V160F	probably damaging	Het
Rapgef3	T	C	15: 97,757,375	D486G	probably damaging	Het
Rev3l	T	G	10: 39,823,985	S1493A	probably benign	Het
Rgs9	T	A	11: 109,225,744	D411V	probably benign	Het
Rgsl1	A	T	1: 153,793,768	Y291N	probably damaging	Het
Rprd2	A	G	3: 95,764,537	Y1185H	probably damaging	Het
Rpusd3	A	G	6: 113,416,206		probably benign	Het
Scnn1a	T	C	6: 125,322,173	I72T	probably damaging	Het
Sdk1	A	T	5: 141,857,003		probably benign	Het
Sfmbt2	T	C	2: 10,445,745	L277P	probably benign	Het
Sgf29	A	G	7: 126,664,982	E73G	probably damaging	Het
Slc12a6	T	A	2: 112,352,961	F764L	probably damaging	Het
Slc4a2	T	C	5: 24,435,342		probably null	Het
Slc9a3	T	G	13: 74,157,719	V285G	probably damaging	Het
Slc9c1	A	G	16: 45,575,409	T608A	probably benign	Het
Slfnl1	C	T	4: 120,535,685	R325C	probably damaging	Het
Smarcad1	T	A	6: 65,074,914	F344I	probably benign	Het
Snrnp70	A	T	7: 45,377,281		probably null	Het
Sod2	C	T	17: 13,008,186	T9M	probably benign	Het
Spag5	T	A	11: 78,314,373	S633T	probably damaging	Het
Spta1	A	T	1: 174,191,056	I531L	probably benign	Het
Stra8	A	G	6: 34,933,156	E60G	probably benign	Het
Sult2a3	T	A	7: 14,111,557	I126F	probably benign	Het
Syt1	T	C	10: 108,504,512	H315R	possibly damaging	Het
Tanc2	T	C	11: 105,867,762	L783P	probably damaging	Het
Thbs2	C	T	17: 14,678,900	C646Y	probably damaging	Het
Ticam2	T	A	18: 46,560,922	K33*	probably null	Het
Trim17	T	C	11: 58,954,301		probably benign	Het
Tsr1	G	A	11: 74,907,879	M691I	probably benign	Het
Ttn	T	A	2: 76,762,419	I20790F	probably damaging	Het
Tubb2b	A	T	13: 34,128,185	Y208*	probably null	Het
Ubr1	T	A	2: 120,914,938	I890F	probably damaging	Het
Usp54	T	C	14: 20,562,192	E852G	probably damaging	Het
Vmn2r78	T	C	7: 86,954,627	V671A	probably damaging	Het
Wipi1	T	C	11: 109,579,649	K315E	probably benign	Het
Xrn2	T	C	2: 147,051,718	V735A	possibly damaging	Het
Zdbf2	T	A	1: 63,308,814	D2117E	possibly damaging	Het
Zfp287	A	T	11: 62,714,136	C648*	probably null	Het
Zfp369	A	G	13: 65,296,800	T586A	possibly damaging	Het

Other mutations in Pik3c2g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Pik3c2g	APN	6	139896125	missense	probably damaging	1.00
IGL01355:Pik3c2g	APN	6	139852857	missense	probably damaging	0.98
IGL01579:Pik3c2g	APN	6	139754741	nonsense	probably null
IGL01580:Pik3c2g	APN	6	139622516	missense	probably damaging	0.99
IGL01587:Pik3c2g	APN	6	139754741	nonsense	probably null
IGL01813:Pik3c2g	APN	6	139622409	missense	possibly damaging	0.55
IGL02218:Pik3c2g	APN	6	139860355	missense	probably damaging	1.00
IGL02479:Pik3c2g	APN	6	139918004	missense	probably benign	0.40
IGL02480:Pik3c2g	APN	6	139852800	missense	probably damaging	1.00
IGL02721:Pik3c2g	APN	6	139736973	missense	probably benign	0.15
IGL02967:Pik3c2g	APN	6	139967828	missense	probably damaging	0.98
IGL03221:Pik3c2g	APN	6	139772407	critical splice acceptor site	probably null
FR4304:Pik3c2g	UTSW	6	139635656	frame shift	probably null
FR4340:Pik3c2g	UTSW	6	139635656	frame shift	probably null
FR4976:Pik3c2g	UTSW	6	139635654	frame shift	probably null
IGL02837:Pik3c2g	UTSW	6	139626564	nonsense	probably null
PIT4531001:Pik3c2g	UTSW	6	139859370	missense
R0002:Pik3c2g	UTSW	6	139768745	missense	probably benign	0.08
R0081:Pik3c2g	UTSW	6	139957793	missense	probably benign	0.05
R0098:Pik3c2g	UTSW	6	139662443	missense	unknown
R0719:Pik3c2g	UTSW	6	139629725	missense	probably damaging	1.00
R0740:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R0837:Pik3c2g	UTSW	6	139957699	splice site	probably benign
R0840:Pik3c2g	UTSW	6	139896072	missense	probably damaging	1.00
R1306:Pik3c2g	UTSW	6	139772428	missense	probably benign
R1501:Pik3c2g	UTSW	6	139844070	critical splice donor site	probably null
R1591:Pik3c2g	UTSW	6	139748178	missense	probably benign	0.00
R1666:Pik3c2g	UTSW	6	139635636	intron	probably benign
R1907:Pik3c2g	UTSW	6	139844042	missense	probably damaging	1.00
R1970:Pik3c2g	UTSW	6	139900386	critical splice donor site	probably null
R1982:Pik3c2g	UTSW	6	139622548	missense	probably damaging	0.97
R2171:Pik3c2g	UTSW	6	139855286	nonsense	probably null
R2188:Pik3c2g	UTSW	6	139852874	missense	probably damaging	1.00
R3777:Pik3c2g	UTSW	6	139622387	missense	probably damaging	1.00
R3778:Pik3c2g	UTSW	6	139622387	missense	probably damaging	1.00
R3965:Pik3c2g	UTSW	6	139855292	missense	possibly damaging	0.90
R4076:Pik3c2g	UTSW	6	139852863	missense	probably damaging	1.00
R4078:Pik3c2g	UTSW	6	139635610	intron	probably benign
R4108:Pik3c2g	UTSW	6	139730370	missense	probably benign	0.00
R4461:Pik3c2g	UTSW	6	139841681	intron	probably benign
R4474:Pik3c2g	UTSW	6	139633751	missense	probably damaging	0.99
R4509:Pik3c2g	UTSW	6	139720006	missense	probably benign	0.25
R4646:Pik3c2g	UTSW	6	139720018	missense	probably benign	0.05
R4732:Pik3c2g	UTSW	6	139935985	missense	probably benign	0.28
R4733:Pik3c2g	UTSW	6	139935985	missense	probably benign	0.28
R4854:Pik3c2g	UTSW	6	139768779	missense	probably damaging	1.00
R4959:Pik3c2g	UTSW	6	139843931	missense	possibly damaging	0.65
R4973:Pik3c2g	UTSW	6	139843931	missense	possibly damaging	0.65
R5032:Pik3c2g	UTSW	6	139896202	missense	probably benign	0.00
R5071:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5072:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5073:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5074:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5107:Pik3c2g	UTSW	6	139635625	intron	probably benign
R5186:Pik3c2g	UTSW	6	139622018	missense	probably damaging	1.00
R5253:Pik3c2g	UTSW	6	139896257	critical splice donor site	probably null
R5359:Pik3c2g	UTSW	6	139622123	missense	probably damaging	1.00
R5394:Pik3c2g	UTSW	6	139720082	missense	probably benign
R5417:Pik3c2g	UTSW	6	139736943	missense	probably benign
R5435:Pik3c2g	UTSW	6	139715855	splice site	probably null
R5580:Pik3c2g	UTSW	6	139626533	missense	probably damaging	0.99
R5664:Pik3c2g	UTSW	6	139737007	missense	probably damaging	0.98
R5908:Pik3c2g	UTSW	6	139768710	missense
R5914:Pik3c2g	UTSW	6	139622479	missense	probably benign	0.00
R6046:Pik3c2g	UTSW	6	139622139	missense	probably damaging	0.96
R6046:Pik3c2g	UTSW	6	139896792	missense	probably damaging	1.00
R6298:Pik3c2g	UTSW	6	139626563	missense	probably damaging	1.00
R6382:Pik3c2g	UTSW	6	139719998	missense	possibly damaging	0.88
R6480:Pik3c2g	UTSW	6	139730469	missense	probably benign	0.27
R6917:Pik3c2g	UTSW	6	139896173	missense	probably benign	0.00
R6929:Pik3c2g	UTSW	6	139957776	missense	possibly damaging	0.67
R7022:Pik3c2g	UTSW	6	139622063	missense	possibly damaging	0.82
R7144:Pik3c2g	UTSW	6	139629870	missense	probably damaging	1.00
R7213:Pik3c2g	UTSW	6	139860264	missense
R7215:Pik3c2g	UTSW	6	139754863	missense
R7332:Pik3c2g	UTSW	6	139896255	missense
R7357:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R7359:Pik3c2g	UTSW	6	139967894	missense	unknown
R7385:Pik3c2g	UTSW	6	139855353	missense
R7455:Pik3c2g	UTSW	6	139967917	missense	unknown
R7651:Pik3c2g	UTSW	6	139622072	missense	possibly damaging	0.85
R7888:Pik3c2g	UTSW	6	139896744	missense
R7923:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R7964:Pik3c2g	UTSW	6	139882060	missense
R8005:Pik3c2g	UTSW	6	139622069	missense	probably benign	0.01
R8371:Pik3c2g	UTSW	6	139936056	missense	unknown
R8724:Pik3c2g	UTSW	6	139967893	missense	unknown
R8733:Pik3c2g	UTSW	6	139768700	nonsense	probably null
R8809:Pik3c2g	UTSW	6	139768710	missense
R8888:Pik3c2g	UTSW	6	139730366	nonsense	probably null
R8931:Pik3c2g	UTSW	6	139875367	missense	probably benign	0.02
R9188:Pik3c2g	UTSW	6	139622403	missense	possibly damaging	0.94
R9336:Pik3c2g	UTSW	6	139875435	missense
R9383:Pik3c2g	UTSW	6	139882016	nonsense	probably null
R9524:Pik3c2g	UTSW	6	139629770	missense	probably damaging	0.99
R9531:Pik3c2g	UTSW	6	139896200	missense
R9630:Pik3c2g	UTSW	6	139622239	missense	possibly damaging	0.66
R9697:Pik3c2g	UTSW	6	139967791	missense	unknown
R9708:Pik3c2g	UTSW	6	139629867	missense	probably benign
R9717:Pik3c2g	UTSW	6	139896184	missense
RF015:Pik3c2g	UTSW	6	139754771	missense
RF032:Pik3c2g	UTSW	6	139635658	frame shift	probably null
X0024:Pik3c2g	UTSW	6	139860258	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTAGAGCCTTGACTCTTCAGG -3'
(R):5'- TGCCTTGCATATGTGACAGAG -3'

Sequencing Primer
(F):5'- CCTTGACTCTTCAGGGTTAACAC -3'
(R):5'- TTGCATATGTGACAGAGGCAAG -3'

Posted On

2016-04-15