Incidental Mutation 'R4928:Myh14'
ID 380996
Institutional Source Beutler Lab
Gene Symbol Myh14
Ensembl Gene ENSMUSG00000030739
Gene Name myosin, heavy polypeptide 14
Synonyms 2400004E04Rik, NMHC II-C
MMRRC Submission 042529-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4928 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 44255227-44320267 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 44284926 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 662 (G662S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048102] [ENSMUST00000107899] [ENSMUST00000107900] [ENSMUST00000207775]
AlphaFold Q6URW6
Predicted Effect probably benign
Transcript: ENSMUST00000048102
SMART Domains Protein: ENSMUSP00000046059
Gene: ENSMUSG00000030739

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
MYSc 95 805 N/A SMART
IQ 806 828 3.91e-4 SMART
Blast:MYSc 839 872 1e-12 BLAST
low complexity region 880 891 N/A INTRINSIC
low complexity region 926 937 N/A INTRINSIC
low complexity region 1005 1013 N/A INTRINSIC
low complexity region 1021 1029 N/A INTRINSIC
low complexity region 1030 1041 N/A INTRINSIC
Pfam:Myosin_tail_1 1094 1951 9.3e-180 PFAM
low complexity region 1955 1966 N/A INTRINSIC
low complexity region 1968 1997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107899
SMART Domains Protein: ENSMUSP00000103531
Gene: ENSMUSG00000030739

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
MYSc 95 797 N/A SMART
IQ 798 820 3.91e-4 SMART
Blast:MYSc 831 864 1e-12 BLAST
low complexity region 872 883 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 997 1005 N/A INTRINSIC
low complexity region 1013 1021 N/A INTRINSIC
low complexity region 1022 1033 N/A INTRINSIC
Pfam:Myosin_tail_1 1086 1943 9e-180 PFAM
low complexity region 1947 1958 N/A INTRINSIC
low complexity region 1960 1989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107900
SMART Domains Protein: ENSMUSP00000103532
Gene: ENSMUSG00000030739

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
MYSc 95 805 N/A SMART
IQ 806 828 3.91e-4 SMART
Pfam:Myosin_tail_1 869 1949 N/A PFAM
low complexity region 1955 1966 N/A INTRINSIC
low complexity region 1968 1997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182648
AA Change: G662S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138739
Gene: ENSMUSG00000030739
AA Change: G662S

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
MYSc 95 838 N/A SMART
IQ 839 861 3.91e-4 SMART
Blast:MYSc 872 905 1e-12 BLAST
low complexity region 913 924 N/A INTRINSIC
low complexity region 959 970 N/A INTRINSIC
low complexity region 1038 1046 N/A INTRINSIC
low complexity region 1054 1062 N/A INTRINSIC
low complexity region 1063 1074 N/A INTRINSIC
Pfam:Myosin_tail_1 1127 1984 9.1e-180 PFAM
low complexity region 1988 1999 N/A INTRINSIC
low complexity region 2001 2030 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207775
AA Change: G662S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208085
Predicted Effect probably benign
Transcript: ENSMUST00000208200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209024
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 98% (123/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-14 (MYO14). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene result in one form of autosomal dominant hearing impairment. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy and survive to adulthood with no apparent defects. About 30% of knock-in mice either heterozygous or homozygous for a single amino acid mutation exhibit increased lymphoma incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530021J07Rik G T 7: 82,805,086 (GRCm39) noncoding transcript Het
Aasdh T A 5: 77,044,535 (GRCm39) K118N possibly damaging Het
Abca14 A T 7: 119,923,803 (GRCm39) N1620I possibly damaging Het
Acap1 A T 11: 69,776,641 (GRCm39) S149T possibly damaging Het
Adgre1 T A 17: 57,751,064 (GRCm39) Y579* probably null Het
Aifm3 T C 16: 17,318,296 (GRCm39) probably benign Het
Aldh16a1 A G 7: 44,791,385 (GRCm39) W107R probably damaging Het
Amer2 A T 14: 60,616,894 (GRCm39) H363L possibly damaging Het
Arhgap10 A G 8: 78,152,957 (GRCm39) probably null Het
Arhgef6 A T X: 56,280,238 (GRCm39) D742E probably damaging Het
Astn2 A T 4: 65,647,644 (GRCm39) N731K probably damaging Het
Atp1a2 T C 1: 172,105,954 (GRCm39) T904A possibly damaging Het
Atr C T 9: 95,789,352 (GRCm39) R1503W probably damaging Het
Cdh3 G T 8: 107,263,242 (GRCm39) R97L probably benign Het
Chst2 C T 9: 95,288,059 (GRCm39) V96I probably benign Het
Cit T A 5: 116,123,856 (GRCm39) N1464K probably benign Het
Col17a1 A T 19: 47,658,897 (GRCm39) probably null Het
Col4a3 G A 1: 82,688,698 (GRCm39) probably benign Het
Copz1 T A 15: 103,199,757 (GRCm39) S57R probably damaging Het
Cpped1 A T 16: 11,646,143 (GRCm39) F227Y probably damaging Het
Cyp2j12 A T 4: 95,990,388 (GRCm39) probably null Het
Dctn1 T A 6: 83,166,189 (GRCm39) I195N possibly damaging Het
Dhrs7b A G 11: 60,742,751 (GRCm39) I148V probably benign Het
Dnah17 T C 11: 117,918,259 (GRCm39) D4096G probably damaging Het
Dnajc13 T C 9: 104,110,837 (GRCm39) N145D possibly damaging Het
Ecpas A G 4: 58,827,073 (GRCm39) V1020A probably damaging Het
Entrep2 G T 7: 64,409,116 (GRCm39) S426* probably null Het
Ercc6l2 T C 13: 64,042,627 (GRCm39) probably benign Het
Fads6 T G 11: 115,187,387 (GRCm39) I103L probably benign Het
Fat4 T G 3: 39,064,614 (GRCm39) Y4857D probably damaging Het
Fbxl14 T A 6: 119,457,671 (GRCm39) L284Q probably damaging Het
Fkbp9 T C 6: 56,826,655 (GRCm39) V85A possibly damaging Het
Galnt13 T A 2: 54,406,577 (GRCm39) V9E probably damaging Het
Gm14412 A T 2: 177,006,373 (GRCm39) S507R probably benign Het
Gm15142 T A X: 153,421,415 (GRCm39) noncoding transcript Het
Gm4787 T C 12: 81,425,612 (GRCm39) E182G probably benign Het
Gm6811 C A 17: 21,314,893 (GRCm39) noncoding transcript Het
Gm9791 A T 3: 34,059,218 (GRCm39) noncoding transcript Het
Hoxb7 A T 11: 96,180,336 (GRCm39) probably null Het
Ift122 T A 6: 115,892,819 (GRCm39) probably benign Het
Krt28 C T 11: 99,265,458 (GRCm39) V70I probably benign Het
Lig1 T C 7: 13,032,664 (GRCm39) S459P probably damaging Het
Lrfn3 C T 7: 30,060,048 (GRCm39) R59H possibly damaging Het
Mavs T C 2: 131,088,663 (GRCm39) V489A probably benign Het
Mcm8 C T 2: 132,681,399 (GRCm39) P625L probably benign Het
Megf10 G T 18: 57,373,745 (GRCm39) R181L probably benign Het
Mgrn1 G A 16: 4,745,726 (GRCm39) G440D probably benign Het
Mllt3 T C 4: 87,700,642 (GRCm39) probably null Het
Muc5ac T A 7: 141,371,639 (GRCm39) Y2613* probably null Het
Myod1 T A 7: 46,026,474 (GRCm39) N126K probably damaging Het
Nae1 A T 8: 105,242,774 (GRCm39) H439Q possibly damaging Het
Narf T A 11: 121,135,765 (GRCm39) V136E possibly damaging Het
Ncapd3 T A 9: 26,983,031 (GRCm39) C926* probably null Het
Ndufv2 C A 17: 66,399,653 (GRCm39) probably null Het
Neb T C 2: 52,102,987 (GRCm39) S449G possibly damaging Het
Nek10 C T 14: 14,930,577 (GRCm38) P698L probably damaging Het
Nox3 T A 17: 3,685,550 (GRCm39) E566V probably null Het
Oas1a C T 5: 121,043,787 (GRCm39) R115H probably benign Het
Or10ag60 C A 2: 87,438,487 (GRCm39) L252I probably benign Het
Or51b6 A G 7: 103,555,879 (GRCm39) T78A probably damaging Het
Or5w19 A G 2: 87,698,574 (GRCm39) M80V probably benign Het
Or8k30 T A 2: 86,339,469 (GRCm39) L222H probably damaging Het
Pbld2 A G 10: 62,883,778 (GRCm39) H142R probably damaging Het
Pcdha4 C T 18: 37,087,869 (GRCm39) T684M probably benign Het
Phc3 G T 3: 31,005,068 (GRCm39) T175N probably damaging Het
Pigs G T 11: 78,219,828 (GRCm39) V68L probably damaging Het
Pik3c2g T A 6: 139,913,528 (GRCm39) D857E possibly damaging Het
Pitpnm3 G A 11: 71,953,998 (GRCm39) P550S probably damaging Het
Pla2g15 G A 8: 106,889,850 (GRCm39) W374* probably null Het
Ptpn14 G A 1: 189,554,839 (GRCm39) C133Y probably damaging Het
Ptpn20 A G 14: 33,336,446 (GRCm39) N95S probably benign Het
Ptrh2 G T 11: 86,580,862 (GRCm39) V160F probably damaging Het
Rapgef3 T C 15: 97,655,256 (GRCm39) D486G probably damaging Het
Rev3l T G 10: 39,699,981 (GRCm39) S1493A probably benign Het
Rgs9 T A 11: 109,116,570 (GRCm39) D411V probably benign Het
Rgsl1 A T 1: 153,669,514 (GRCm39) Y291N probably damaging Het
Rprd2 A G 3: 95,671,849 (GRCm39) Y1185H probably damaging Het
Rpusd3 A G 6: 113,393,167 (GRCm39) probably benign Het
Scnn1a T C 6: 125,299,136 (GRCm39) I72T probably damaging Het
Sdk1 A T 5: 141,842,758 (GRCm39) probably benign Het
Sfmbt2 T C 2: 10,450,556 (GRCm39) L277P probably benign Het
Sgf29 A G 7: 126,264,154 (GRCm39) E73G probably damaging Het
Slc12a6 T A 2: 112,183,306 (GRCm39) F764L probably damaging Het
Slc4a2 T C 5: 24,640,340 (GRCm39) probably null Het
Slc9a3 T G 13: 74,305,838 (GRCm39) V285G probably damaging Het
Slc9c1 A G 16: 45,395,772 (GRCm39) T608A probably benign Het
Slfnl1 C T 4: 120,392,882 (GRCm39) R325C probably damaging Het
Smarcad1 T A 6: 65,051,898 (GRCm39) F344I probably benign Het
Snrnp70 A T 7: 45,026,705 (GRCm39) probably null Het
Sod2 C T 17: 13,227,073 (GRCm39) T9M probably benign Het
Spag5 T A 11: 78,205,199 (GRCm39) S633T probably damaging Het
Spta1 A T 1: 174,018,622 (GRCm39) I531L probably benign Het
Stra8 A G 6: 34,910,091 (GRCm39) E60G probably benign Het
Sult2a3 T A 7: 13,845,482 (GRCm39) I126F probably benign Het
Syt1 T C 10: 108,340,373 (GRCm39) H315R possibly damaging Het
Tanc2 T C 11: 105,758,588 (GRCm39) L783P probably damaging Het
Thbs2 C T 17: 14,899,162 (GRCm39) C646Y probably damaging Het
Ticam2 T A 18: 46,693,989 (GRCm39) K33* probably null Het
Trim17 T C 11: 58,845,127 (GRCm39) probably benign Het
Tsr1 G A 11: 74,798,705 (GRCm39) M691I probably benign Het
Ttn T A 2: 76,592,763 (GRCm39) I20790F probably damaging Het
Tubb2b A T 13: 34,312,168 (GRCm39) Y208* probably null Het
Ubr1 T A 2: 120,745,419 (GRCm39) I890F probably damaging Het
Usp54 T C 14: 20,612,260 (GRCm39) E852G probably damaging Het
Vmn2r78 T C 7: 86,603,835 (GRCm39) V671A probably damaging Het
Wipi1 T C 11: 109,470,475 (GRCm39) K315E probably benign Het
Xrn2 T C 2: 146,893,638 (GRCm39) V735A possibly damaging Het
Zdbf2 T A 1: 63,347,973 (GRCm39) D2117E possibly damaging Het
Zfp287 A T 11: 62,604,962 (GRCm39) C648* probably null Het
Zfp369 A G 13: 65,444,614 (GRCm39) T586A possibly damaging Het
Other mutations in Myh14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Myh14 APN 7 44,255,716 (GRCm39) unclassified probably benign
IGL01431:Myh14 APN 7 44,263,782 (GRCm39) missense probably null 0.00
IGL01722:Myh14 APN 7 44,292,956 (GRCm39) missense probably damaging 1.00
IGL01806:Myh14 APN 7 44,307,363 (GRCm39) missense probably benign 0.19
IGL02034:Myh14 APN 7 44,265,717 (GRCm39) missense possibly damaging 0.58
IGL02260:Myh14 APN 7 44,260,995 (GRCm39) missense probably damaging 1.00
IGL02590:Myh14 APN 7 44,273,503 (GRCm39) missense probably damaging 1.00
IGL02696:Myh14 APN 7 44,314,530 (GRCm39) missense probably damaging 1.00
IGL02705:Myh14 APN 7 44,257,960 (GRCm39) missense possibly damaging 0.66
IGL03193:Myh14 APN 7 44,279,369 (GRCm39) missense possibly damaging 0.91
PIT4581001:Myh14 UTSW 7 44,262,906 (GRCm39) missense probably benign 0.04
R0067:Myh14 UTSW 7 44,272,551 (GRCm39) missense probably benign 0.05
R0083:Myh14 UTSW 7 44,283,943 (GRCm39) missense probably damaging 0.98
R0108:Myh14 UTSW 7 44,283,943 (GRCm39) missense probably damaging 0.98
R0152:Myh14 UTSW 7 44,272,605 (GRCm39) missense probably damaging 1.00
R0369:Myh14 UTSW 7 44,310,374 (GRCm39) missense probably damaging 1.00
R0552:Myh14 UTSW 7 44,263,105 (GRCm39) missense probably damaging 1.00
R0699:Myh14 UTSW 7 44,274,395 (GRCm39) missense possibly damaging 0.67
R0763:Myh14 UTSW 7 44,314,791 (GRCm39) missense probably damaging 0.98
R1079:Myh14 UTSW 7 44,279,426 (GRCm39) missense probably damaging 1.00
R1388:Myh14 UTSW 7 44,314,546 (GRCm39) missense probably damaging 0.98
R1432:Myh14 UTSW 7 44,265,723 (GRCm39) missense probably damaging 1.00
R1568:Myh14 UTSW 7 44,261,122 (GRCm39) nonsense probably null
R1579:Myh14 UTSW 7 44,305,118 (GRCm39) splice site probably null
R1598:Myh14 UTSW 7 44,287,818 (GRCm39) missense probably damaging 0.96
R1848:Myh14 UTSW 7 44,281,853 (GRCm39) missense probably damaging 0.98
R1869:Myh14 UTSW 7 44,261,067 (GRCm39) missense possibly damaging 0.95
R1917:Myh14 UTSW 7 44,307,349 (GRCm39) missense probably benign
R1933:Myh14 UTSW 7 44,264,772 (GRCm39) missense probably benign 0.09
R1984:Myh14 UTSW 7 44,288,446 (GRCm39) missense probably damaging 1.00
R2154:Myh14 UTSW 7 44,301,853 (GRCm39) critical splice donor site probably null
R2190:Myh14 UTSW 7 44,310,487 (GRCm39) missense probably damaging 1.00
R2217:Myh14 UTSW 7 44,283,800 (GRCm39) missense probably damaging 1.00
R2239:Myh14 UTSW 7 44,314,607 (GRCm39) missense probably damaging 1.00
R2918:Myh14 UTSW 7 44,265,687 (GRCm39) missense possibly damaging 0.91
R4091:Myh14 UTSW 7 44,282,415 (GRCm39) missense possibly damaging 0.93
R4110:Myh14 UTSW 7 44,277,974 (GRCm39) missense probably benign 0.00
R4199:Myh14 UTSW 7 44,264,927 (GRCm39) nonsense probably null
R4507:Myh14 UTSW 7 44,279,415 (GRCm39) missense probably benign 0.00
R4539:Myh14 UTSW 7 44,276,478 (GRCm39) missense probably damaging 1.00
R4550:Myh14 UTSW 7 44,283,857 (GRCm39) missense probably damaging 1.00
R4673:Myh14 UTSW 7 44,273,754 (GRCm39) missense probably damaging 1.00
R4768:Myh14 UTSW 7 44,263,099 (GRCm39) missense probably benign 0.19
R4832:Myh14 UTSW 7 44,274,566 (GRCm39) missense probably benign 0.31
R4853:Myh14 UTSW 7 44,257,872 (GRCm39) missense probably damaging 1.00
R4901:Myh14 UTSW 7 44,310,464 (GRCm39) missense probably damaging 1.00
R5070:Myh14 UTSW 7 44,265,672 (GRCm39) missense possibly damaging 0.91
R5166:Myh14 UTSW 7 44,278,279 (GRCm39) missense probably damaging 0.99
R5726:Myh14 UTSW 7 44,292,886 (GRCm39) critical splice donor site probably null
R5786:Myh14 UTSW 7 44,262,887 (GRCm39) missense probably benign 0.23
R5895:Myh14 UTSW 7 44,256,133 (GRCm39) missense probably damaging 1.00
R5961:Myh14 UTSW 7 44,272,518 (GRCm39) missense probably damaging 0.96
R6014:Myh14 UTSW 7 44,274,502 (GRCm39) missense probably null
R6080:Myh14 UTSW 7 44,305,035 (GRCm39) missense probably damaging 1.00
R6187:Myh14 UTSW 7 44,276,457 (GRCm39) missense probably damaging 1.00
R6657:Myh14 UTSW 7 44,287,270 (GRCm39) missense probably damaging 1.00
R6833:Myh14 UTSW 7 44,273,803 (GRCm39) nonsense probably null
R6894:Myh14 UTSW 7 44,282,936 (GRCm39) missense probably damaging 1.00
R6916:Myh14 UTSW 7 44,278,737 (GRCm39) missense probably damaging 0.96
R6962:Myh14 UTSW 7 44,307,363 (GRCm39) missense probably benign 0.36
R7066:Myh14 UTSW 7 44,280,179 (GRCm39) missense possibly damaging 0.69
R7261:Myh14 UTSW 7 44,273,761 (GRCm39) nonsense probably null
R7303:Myh14 UTSW 7 44,261,125 (GRCm39) missense probably damaging 1.00
R7304:Myh14 UTSW 7 44,279,415 (GRCm39) missense probably benign 0.00
R7327:Myh14 UTSW 7 44,260,977 (GRCm39) missense possibly damaging 0.53
R7380:Myh14 UTSW 7 44,310,466 (GRCm39) missense probably damaging 1.00
R7570:Myh14 UTSW 7 44,281,850 (GRCm39) missense probably benign 0.37
R7622:Myh14 UTSW 7 44,281,846 (GRCm39) missense probably benign 0.25
R7681:Myh14 UTSW 7 44,273,572 (GRCm39) missense possibly damaging 0.81
R7718:Myh14 UTSW 7 44,310,464 (GRCm39) missense probably damaging 1.00
R7910:Myh14 UTSW 7 44,281,819 (GRCm39) missense probably damaging 1.00
R8054:Myh14 UTSW 7 44,274,551 (GRCm39) missense probably damaging 0.97
R8088:Myh14 UTSW 7 44,314,920 (GRCm39) start codon destroyed probably null 0.94
R8164:Myh14 UTSW 7 44,274,457 (GRCm39) missense probably benign 0.01
R8260:Myh14 UTSW 7 44,264,800 (GRCm39) missense probably damaging 1.00
R8299:Myh14 UTSW 7 44,276,472 (GRCm39) missense probably damaging 1.00
R8410:Myh14 UTSW 7 44,282,907 (GRCm39) missense probably damaging 1.00
R8723:Myh14 UTSW 7 44,272,407 (GRCm39) missense probably damaging 1.00
R8853:Myh14 UTSW 7 44,265,678 (GRCm39) missense probably benign 0.08
R8934:Myh14 UTSW 7 44,306,852 (GRCm39) missense probably benign
R9169:Myh14 UTSW 7 44,271,281 (GRCm39) missense possibly damaging 0.73
R9395:Myh14 UTSW 7 44,274,584 (GRCm39) missense possibly damaging 0.66
R9451:Myh14 UTSW 7 44,273,743 (GRCm39) critical splice donor site probably null
X0026:Myh14 UTSW 7 44,263,818 (GRCm39) missense probably benign 0.00
X0063:Myh14 UTSW 7 44,273,557 (GRCm39) missense probably damaging 1.00
Z1176:Myh14 UTSW 7 44,287,733 (GRCm39) missense probably damaging 0.98
Z1176:Myh14 UTSW 7 44,257,939 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAGAACCACCAAGGGCTC -3'
(R):5'- GGACTTGATTAGGTCACAGGC -3'

Sequencing Primer
(F):5'- CACCAAGGGCTCAGCAAGG -3'
(R):5'- CTTGATTAGGTCACAGGCAACAGC -3'
Posted On 2016-04-15